Longevity Effect of Liuwei Dihuang in Both Caenorhabditis Elegans and Aged Mice
Chen Weidong, Wang Jinzeng, Shi Jiahao, Yang Xu, Yang Ping, Wang Ning, Yang Sai, Xie Tianpei, Yang Hua, Zhang Mengjie, Wang Haiyun, Fei Jian
Table 1 List of the primers used in the present study.
GeneForward SequenceReverse Sequence
sea-1ATTGAGAAGAGCCGGAAGCCTGACACCGTCACGAATGAGG
skr-9TCGACTTGATCGTTGCCTGTCTGCGTCCTTGTCGGTGAT
ctl-2TCCCAGATGGGTACCGTCATGGTCCGAAGAGGCAAGTTGA
F42A10.6TACCAACGGAGTACCATGCCCTTCCTTGCTCGGGTCATCA
cpr-1AGACTACCACGGAGCTGGATTTGGAACAGCGTAGGCAGAG
ugt-41TGCGATCTGCCTTGCATAGTTACTATCTTGTGCCGGCTGC
nhr-68GTAGGAATGGACAAGACTCCCGAAGAGGAGATAACTG
dod-3GTGCATATTGTGGAGCTGCGGTACTTGCACGCTGCGAAAA
lipl-4CTCAAAAAGTGTCGATCTTGAGTTGATGAGGTGAATTGGCGACC
vit-5TCTGGACTCCCAACCGCAATTTGAGCACGGAATGGAAGC
sod-3ATCTACTGCTCGCACTGCTTTGTTCACGTAGGTGGCATGA
mtl-1TGTGAGGAGGCCAGTGAGATTAATGAGCCGCAGCAGTT
act-4GCCACCGCTGCCTCCTCATCCCGGCAGACTCCATACCCAAGAAG