Please wait a minute...
 Home  About the Journal Editorial Board Aims & Scope Peer Review Policy Subscription Contact us
 
Early Edition  //  Current Issue  //  Open Special Issues  //  Archives  //  Most Read  //  Most Downloaded  //  Most Cited
Aging and disease    2018, Vol. 9 Issue (2) : 249-261     DOI: 10.14336/AD.2017.0424
Orginal Article |
Temporal Gene Expression Profiles after Focal Cerebral Ischemia in Mice
Zhang Chengjie1,2,3, Zhu Yanbing2, Wang Song2,3, Zachory Wei Zheng1,2,3, Jiang Michael Qize3, Zhang Yongbo1,2, Pan Yuhualei1,2, Tao Shaoxin1,2, Li Jimei1,2,*, Wei Ling1,2,3,*
1Department of Neurology, Beijing Friendship Hospital, Capital Medical University, Beijing 100050, China.
2Laboratories of Stem Cell Biology and Neural Regeneration and Function Recovery, Beijing Friendship Hospital, Capital Medical University, Beijing 100050, China.
3Department of Anesthesiology, Emory University School of Medicine, Atlanta, GA 30322, USA.
Download: PDF(2155 KB)   HTML
Export: BibTeX | EndNote | Reference Manager | ProCite | RefWorks    
Abstract  

A cascade of pathological processes is triggered in the lesion area after ischemic stroke. Unfortunately, our understanding of these complicated molecular events is incomplete. In this investigation, we sought to better understand the detailed molecular and inflammatory events occurring after ischemic stroke. RNA-seq technology was used to identify whole gene expression profiles at days (D1, D3, D7, D14, D21) after focal cerebral ischemia in mice. Enrichment analyses based on Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) terms for the differentially expressed genes (DEGs) were then analyzed. Inflammation-related genes that were significantly expressed after stroke were selected for analysis and the temporal expression patterns of pro-inflammatory and anti-inflammatory genes were reported. These data illustrated that the number of DEGs increased accumulatively after cerebral ischemia. In summary, there were 1967 DEGs at D1, 2280 DEGs at D3, 2631 DEGs at D7, 5516 DEGs at D14 and 7093 DEGs at D21. The significantly enriched GO terms also increased. 58 GO terms and 18 KEGG pathways were significantly enriched at all inspected time points. We identified 87 DEGs which were functionally related to inflammatory responses. The expression levels of pro-inflammation related genes CD16, CD32, CD86, CD11b, Tumour necrosis factor α (TNF-α), Interleukin 1β (IL-1β) increased over time and peaked at D14. Anti-inflammation related genes Arginase 1 (Arg1) and Chitinase-like 3 (Ym1) peaked at D1 while IL-10, Transforming growth factor β (TGF-β) and CD206, which were induced at 1 day after cerebral ischemia, peaked by 7 to 14 days. These gene profile changes were potentially linked to microglia/macrophage phenotype changes and could play a role in astroglial activation. This study supplies new insights and detailed information on the molecular events and pathological mechanisms that occur after experimental ischemic stroke.

Keywords experimental cerebral ischemia      RNA-seq      differentially expressed genes      inflammation related genes     
Corresponding Authors: Li Jimei,Wei Ling   
About author:

These authors contributed equally to this work.

Issue Date: 01 April 2018
Service
E-mail this article
E-mail Alert
RSS
Articles by authors
Zhang Chengjie
Zhu Yanbing
Wang Song
Zachory Wei Zheng
Jiang Michael Qize
Zhang Yongbo
Pan Yuhualei
Tao Shaoxin
Li Jimei
Wei Ling
Cite this article:   
Zhang Chengjie,Zhu Yanbing,Wang Song, et al. Temporal Gene Expression Profiles after Focal Cerebral Ischemia in Mice[J]. Aging and disease, 2018, 9(2): 249-261.
URL:  
http://www.aginganddisease.org/EN/10.14336/AD.2017.0424     OR     http://www.aginganddisease.org/EN/Y2018/V9/I2/249
Gene namePrimerSequence (5’–3’)
CD32ForwardAGGGCCTCCATCTGGACTG
ReverseGTGGTTCTGGTAATCATGCTCTG
CD86ForwardGGTGGCCTTTTTGACACTCTC
ReverseTGAGGTAGAGGTAGGAGGATCTT
CD206ForwardGAGGGAAGCGAGAGATTATGGA
ReverseGCCTGATGCCAGGTTAAAGCA
Arg1ForwardCTCCAAGCCAAAGTCCTTAGAG
ReverseAGGAGCTGTCATTAGGGACATC
Ym-1ForwardAGGACTCCTGGCTTACTATGA
ReverseAACCAACCCACTCATTACCC
TGF βForwardTCTGCATTGCACTTATGCTGA
ReverseAAAGGGCGATCTAGTGATGGA
beta-actinForwardGGCTGTATTCCCCTCCATCG
ReverseCCAGTTGGTAACAATGCCATGT
Table 1  The primers for qRT-PCR.
Gene Namelog2Fold ChangepvalDescription
D1Mmp39.0956.55E-16matrix metallopeptidase 3
Il118.4091.02E-05interleukin 11
Ccl47.7865.06E-11chemokine (C-C motif) ligand 4
Ccl27.72541.65E-33chemokine (C-C motif) ligand 2
Arg17.57037.02E-20arginase
Il67.16522.31E-14interleukin 6
Tfpi26.90834.82E-07tissue factor pathway inhibitor 2
Clec4e6.81670.0003859C-type lectin domain family 4, member e
Ptx36.76672.63E-35pentraxin related gene
Ccl126.71281.92E-49chemokine (C-C motif) ligand 12
D3Apoc28.29175.43E-06apolipoprotein C-II
Nxpe57.80311.87E-07neurexophilin and PC-esterase domain family, member 5
Aplnr7.22691.86E-12apelin receptor
Cd5l7.17345.37E-06CD5 antigen-like
Tfpi26.94590.0046113tissue factor pathway inhibitor 2
Arg16.83940.0031864arginase
Pyhin16.77449.15E-05pyrin and HIN domain family, member 1
Bub16.77044.73E-08budding uninhibited by benzimidazoles 1 homolog
Cdk16.59854.27E-13cyclin-dependent kinase 1
Msr16.47530.0015781macrophage scavenger receptor 1
D7Apoc29.91065.20E-06apolipoprotein C-II
Gpnmb9.85640.0072568glycoprotein (transmembrane) nmb
Spp19.8420.0091977secreted phosphoprotein 1
Cd5l9.76190.00099001CD5 antigen-like
Mmp39.40580.018527matrix metallopeptidase 3
H199.24540.0029637H19, imprinted maternally expressed transcript
Mmp139.06370.017491matrix metallopeptidase 13
Clec7a8.97040.0010311C-type lectin domain family 7, member a
Mcoln38.850.014833mucolipin 3
Lgals38.82090.0018961lectin, galactose binding, soluble 3
D14Mmp312.8889.44E-22matrix metallopeptidase 3
Saa312.0071.24E-49serum amyloid A 3
Oas310.5352.03E-072’-5’ oligoadenylate synthetase 3
Pyhin110.5291.01E-05pyrin and HIN domain family, member 1
Mmp1310.4212.20E-25matrix metallopeptidase 13
Apoc210.1861.58E-30apolipoprotein C-II
Cst710.0953.66E-20cystatin F (leukocystatin)
Clec7a9.82547.85E-09C-type lectin domain family 7, member a
Ccl59.82289.61E-28chemokine (C-C motif) ligand 5
Mmp129.45187.62E-35matrix metallopeptidase 12
D21Igha13.0671.41E-92immunoglobulin heavy constant alpha
Mmp312.2091.35E-78matrix metallopeptidase 3
Cd5l11.7641.43E-13CD5 antigen-like
Saa310.7942.78E-28serum amyloid A 3
C310.2768.25E-29complement component 3
Clec7a10.2281.63E-17C-type lectin domain family 7, member a
Igkc10.1133.13E-85immunoglobulin kappa constant
Ccl510.1083.02E-43chemokine (C-C motif) ligand 5
Mmp1210.0823.63E-08matrix metallopeptidase 12
Cxcl139.8252.95E-07chemokine (C-X-C motif) ligand 13
Table 2  The top 10 highest DEGs at different time points.
Figure 1.  TTC staining and differentially expressed genes after cerebral ischemia. A) TTC staining of brain at D1 after ischemic stroke showing the ischemic lesion area in the cortex (white). B) Heatmap of the up-regulated and down-regulated DEGs between the post-stroke groups and sham group. C) The number of upregulated and downregulated DEGs at different time points. Increase in the total DEG numbers were observed over time from Day 7 to Day 21 after stroke.
Figure 2.  Gene ontology enrichment analysis of the DEGs at all the time points after cerebral ischemia. A) 27 significant terms of biological process were enriched at all the inspected time points and the number of DEGs in the terms were increased (1.immune response 2.immune system process 3.production of molecular mediator involved in inflammatory response 4.regulation of cell death 5.regulation of apoptotic process 6.regulation of programmed cell death 7.regulation of autophagy 8.autophagy 9.apoptotic process 10.programmed cell death 11.positive regulation of autophagy 12.positive regulation of catabolic process 13.positive regulation of cellular catabolic process 14.divalent metal ion transport 15.iron ion transport 16.ion transport 17.small GTPase mediated signal transduction 18.intracellular signal transduction 19.regulation of microtubule-based process 20.regulation of microtubule cytoskeleton organization 21.microtubule polymerization or depolymerization 22.regulation of microtubule polymerization or depolymerization 23.cell adhesion 24.biological adhesion 25.protein complex assembly 26.protein complex biogenesis 27.protein phosphorylation). B) 31 significant terms in molecular function were enriched at all the different time points and the number of DEGs in these terms were increased (1. guanyl ribonucleotide binding 2. guanyl nucleotide binding 3. purine nucleotide binding 4. purine nucleoside binding 5. ribonucleoside binding 6. purine ribonucleoside binding 7. purine ribonucleoside triphosphate binding 8. purine ribonucleotide binding 9. ribonucleotide binding 10. nucleoside binding 11. nucleoside-triphosphatase activity 12. pyrophosphatase activity 13. hydrolase activity, acting on acid anhydrides, in phosphorus-containing anhydrides 14. hydrolase activity, acting on glycosyl bonds 15. hydrolase activity 16. hydrolase activity, hydrolyzing O-glycosyl compounds 17. chemokine activity 18. chemokine receptor binding 19. cytokine activity 20. cytokine receptor binding 21. cytokine receptor activity 22. protein binding 23. calcium ion binding 24. binding 25. GTP binding 26. G-protein coupled receptor binding 27. lipid binding 28. GTPase activity 29. anion binding 30. iron ion transmembrane transporter activity 31. glutathione peroxidase activity).
DescriptionInput number of genes
Total number
D1D3D7D14D21
Function related pathways
TNF signaling pathway4130316167109
Phagosome5253568598174
ECM-receptor interaction323424495488
Platelet activation4041366679131
Fc gamma R-mediated phagocytosis272625516088
NOD-like receptor signaling pathway201620353958
B cell receptor signaling pathway202322425073
Cell adhesion molecules (CAMs)4141537891160
Osteoclast differentiation4543437379126
Disease related pathways
Pertussis312727485174
Leishmaniasis282527424565
Staphylococcus aureus infection242728353451
Tuberculosis53515289106176
Chagas disease (American trypanosomiasis)3528275971103
Rheumatoid arthritis302428445782
Toxoplasmosis3629365468113
Amoebiasis3732315869119
Inflammatory bowel disease (IBD)211922333859
Table 3  The KEGG pathways significantly enriched at all the time points.
Figure 3.  The DEGs associated with TNF signaling pathway at different time points after cerebral ischemia. The upregulated genes are boxed in red and the down-regulated genes in blue. Arrows indicate the time points of up-regulated genes (red) and down-regulated genes (blue).
Figure 4.  Expression levels (FPKM value) of the pro-inflammatory and anti-inflammation related genes that were significantly expressed after cerebral ischemia. A) The pro-inflammatory related genes (CD16, CD32, CD86, CD11b, TNF-a and IL-1b); B) The anti-inflammation related genes (CD206, Arg1, Ym1, IL-10 and TGF β).
CategoryGene symbols
Cytokine and receptorsIfngr1 IL-10rb Il13ra1 Il17rc Il18rap Il21r Il2rg Il33 Il4ra Tnfaip2 Tnfrsf10b Tnfrsf13b Tnfrsf1a Tnfrsf1b Tnfrsf26 Csf1 Csf2rb Csf2rb2 Ccl12 Ccl3 Ccl4 Ccl5 Ccl6 Ccl7 Ccl9 Ccr1 Ccr2 Ccr5 Cmklr1 Cx3cr1 Cxcl10 Cxcl16
Complement and receptorsC1qa C1qb C1qc C1rl C3 C3ar1 C4b C5ar1 C5ar2
Surface antigensCd14 Cd151 Cd180 Cd248 Cd300lb Cd300ld Cd300lf Cd36 Cd37 Cd38 Cd44 Cd48 Cd52 Cd53 Cd5l Cd63 Cd68 Cd72 Cd74 Cd82 Cd84 Cd86 Cd9 Itgax Itgb2 Itgb7 Scarf1 Scarf2 Tlr1 Tlr13 Tlr2
C-type lectin familyClec14a Clec2d Clec4a1 Clec4a2 Clec4n Clec7a
Major histocompatibility complexH2-Aa H2-Ab1 H2-D1 H2-DMb1 H2-Eb1 H2-K1 H2-Q4 H2-Q5 H2-Q6
Table 4  The inflammatory related genes significantly expressed at all the time points.
Figure 5.  Identification of the temporal expressions of inflammatory response related genes with qRT-PCR. The expression level of CD32 (A) continuously increased and remained elevated at D21 after ischemic stroke. The level of CD86 (B) gradually increased at D1 and peaked at D14 after ischemic stroke. Expression levels of CD206 (C) and TGF-β (F) peaked at D7. Levels of Arg1 (D) and Ym1 (E) peaked at D1.
Figure 6.  Microglia/macrophages and astrocytes in peri-infarct regions. Iba-1 (Green), NeuN (Red), and Hoechst (Blue) immunostaining at 7 days post ischemic stroke (A-C) featuring primarily ramified microglia. At a later time point of D14 (D-F), microglia displayed a more phagocytic phenotype. The level of GFAP also steadily increased over time starting from D1. GFAP staining shown at D7 (C) and D14 (F).
[1] Mozaffarian D, Benjamin EJ, Go AS, Arnett DK, Blaha MJ, Cushman M, et al. (2016). Executive Summary: Heart Disease and Stroke Statistics--2016 Update: A Report From the American Heart Association. Circulation, 133: 447-454.
[2] Dirnagl U, Iadecola C, Moskowitz MA (1999). Pathobiology of ischaemic stroke: an integrated view. Trends Neurosci, 22: 391-397.
[3] Iadecola C, Anrather J (2011). The immunology of stroke: from mechanisms to translation. Nat Med, 17: 796-808.
[4] Lo EH, Dalkara T, Moskowitz MA (2003). Mechanisms, challenges and opportunities in stroke. Nature reviews. Neurosci, 4: 399-415.
[5] Vidale S, Consoli A, Arnaboldi M, Consoli D (2017). Postischemic Inflammation in Acute Stroke. J Clin Neurol (Seoul, Korea), 13: 1-9.
[6] Kim JY, Park J, Chang JY, Kim SH, Lee JE (2016). Inflammation after Ischemic Stroke: The Role of Leukocytes and Glial Cells. Exp Neurobiol, 25:241-51.
[7] Selvaraj UM, Poinsatte K, Torres V, Ortega SB, Stowe AM (2016). Heterogeneity of B Cell Functions in Stroke-Related Risk, Prevention, Injury, and Repair. Neurotherap, 13: 729-747.
[8] Xiong XY, Liu L, Yang QW (2016). Functions and mechanisms of microglia/macrophages in neuroinflammation and neurogenesis after stroke. Prog Neurobiol, 142: 23-44.
[9] Huang M, Wan Y, Mao L, He QW, Xia YP, Li M, et al. (2017). Inhibiting the Migration of M1 Microglia at Hyperacute Period Could Improve Outcome of tMCAO Rats. CNS Neurosci & Therap, 23:222-232.
[10] Meller R, Pearson AN, Hardy JJ, Hall CL, McGuire D, Frankel MR, et al. (2016). Blood transcriptome changes after stroke in an African American population. Ann Clin Transl Neurol, 3: 70-81.
[11] Pereira AC, Gray JD, Kogan JF, Davidson RL, Rubin TG, Okamoto M, et al. (2017). Age and Alzheimer’s disease gene expression profiles reversed by the glutamate modulator riluzole. Mol Psychiatry, 22: 296-305.
[12] Chen K, Deng S, Lu H, Zheng Y, Yang G, Kim D, et al. (2013). RNA-seq characterization of spinal cord injury transcriptome in acute/subacute phases: a resource for understanding the pathology at the systems level. PloS One, 8: e72567.
[13] Li J, Li Y, Ogle M, Zhou X, Song M, Yu SP, et al. (2010). DL-3-n-butylphthalide prevents neuronal cell death after focal cerebral ischemia in mice via the JNK pathway. Brain Res, 1359: 216-226.
[14] Ramos-Cejudo J, Gutierrez-Fernandez M, Rodriguez-Frutos B, Exposito Alcaide M, Sanchez-Cabo F, Dopazo A, et al. (2012). Spatial and temporal gene expression differences in core and periinfarct areas in experimental stroke: a microarray analysis. PloS One, 7: e52121.
[15] Morancho A, Rosell A, Garcia-Bonilla L, Montaner J (2010). Metalloproteinase and stroke infarct size: role for anti-inflammatory treatment? Ann N Y Acad Sci, 1207: 123-133.
[16] Cai H, Mu Z, Jiang Z, Wang Y, Yang GY, Zhang Z (2015). Hypoxia-controlled matrix metalloproteinase-9 hyperexpression promotes behavioral recovery after ischemia. Neurosci Bull, 31: 550-560.
[17] Sezer S, Ucar F, Ulusoy EK, Erdogan S, Bilen S, Zungun C, et al. (2014). Serum amyloid A, fetuin-A, and pentraxin-3 levels in patients with ischemic stroke: novel prognostic biomarkers? Turkish J Med Sci, 44: 16-23.
[18] Bonaventura A, Liberale L, Vecchie A, Casula M, Carbone F, Dallegri F, et al. (2016). Update on Inflammatory Biomarkers and Treatments in Ischemic Stroke. International J Mol Sci, 17:E1967.
[19] Pascotini ET, Flores AE, Kegler A, Gabbi P, Bochi GV, Algarve TD, et al. (2015). Apoptotic markers and DNA damage are related to late phase of stroke: Involvement of dyslipidemia and inflammation. Physiol Behav, 151: 369-378.
[20] Jia J, Guan D, Zhu W, Alkayed NJ, Wang MM, Hua Z, et al. (2009). Estrogen inhibits Fas-mediated apoptosis in experimental stroke. Exper Neurol, 215: 48-52.
[21] Xu XR, Carrim N, Neves MA, McKeown T, Stratton TW, Coelho RM, et al. (2016). Platelets and platelet adhesion molecules: novel mechanisms of thrombosis and anti-thrombotic therapies. Thrombosis J, 14: 29.
[22] Choi JS, Park J, Suk K, Moon C, Park YK, Han HS (2011). Mild Hypothermia Attenuates Intercellular Adhesion Molecule-1 Induction via Activation of Extracellular Signal-Regulated Kinase-1/2 in a Focal Cerebral Ischemia Model. Stroke Res Treat, 2011: 846716.
[23] Davis SM, Collier LA, Leonardo CC, Seifert HA, Ajmo CT Jr., Pennypacker KR (2017). Leukemia Inhibitory Factor Protects Neurons from Ischemic Damage via Upregulation of Superoxide Dismutase 3. Mol Neurobiol, 54: 608-622.
[24] Pfluecke C, Berndt K, Wydra S, Tarnowski D, Barthel P, Quick S, et al. (2016). Atrial fibrillation is associated with high levels of monocyte-platelet-aggregates and increased CD11b expression in patients with aortic stenosis. Thrombosis Haemostasis, 115: 993-1000.
[25] He Y, Ma X, Li D, Hao J (2016). Thiamet G mediates neuroprotection in experimental stroke by modulating microglia/macrophage polarization and inhibiting NF-kappaB p65 signaling. J Cereb Blood Flow Met, 0:1-14.
[26] Mantani PT, Ljungcrantz I, Andersson L, Alm R, Hedblad B, Bjorkbacka H, et al. (2014). Circulating CD40+ and CD86+ B cell subsets demonstrate opposing associations with risk of stroke. Arterioscl Thrombosis Vasc Biol, 34: 211-218.
[27] Hu X, Li P, Guo Y, Wang H, Leak RK, Chen S, et al. (2012). Microglia/macrophage polarization dynamics reveal novel mechanism of injury expansion after focal cerebral ischemia. Stroke, 43: 3063-3070.
[28] Jeong SI, Shin JA, Cho S, Kim HW, Lee JY, Kang JL, et al. (2016). Resveratrol attenuates peripheral and brain inflammation and reduces ischemic brain injury in aged female mice. Neurobiol Aging, 44: 74-84.
[29] O’Hare FM, Watson W, O’Neill A, Grant T, Onwuneme C, Donoghue V, et al. (2015). Neutrophil and monocyte toll-like receptor 4, CD11b and reactive oxygen intermediates, and neuroimaging outcomes in preterm infants. Pediat Res, 78: 82-90.
[30] Shin JA, Lim SM, Jeong SI, Kang JL, Park EM (2014). Noggin improves ischemic brain tissue repair and promotes alternative activation of microglia in mice. Brain, Behav, Immun, 40: 143-154.
[31] Cuartero MI, Ballesteros I, Moraga A, Nombela F, Vivancos J, Hamilton JA, et al. (2013). N2 neutrophils, novel players in brain inflammation after stroke: modulation by the PPARgamma agonist rosiglitazone. Stroke, 44: 3498-3508.
[32] Li C, Wang J, Fang Y, Liu Y, Chen T, Sun H, et al. (2016). Nafamostat mesilate improves function recovery after stroke by inhibiting neuroinflammation in rats. Brain Behav Immun, 56: 230-245.
No related articles found!
Viewed
Full text


Abstract

Cited

  Shared   
Copyright © 2014 Aging and Disease, All Rights Reserved.
Address: Aging and Disease Editorial Office 3400 Camp Bowie Boulevard Fort Worth, TX76106 USA
Fax: (817) 735-0408 E-mail: editorial@aginganddisease.org
Powered by Beijing Magtech Co. Ltd