Please wait a minute...
 Home  About the Journal Editorial Board Aims & Scope Peer Review Policy Subscription Contact us
 
Early Edition  //  Current Issue  //  Open Special Issues  //  Archives  //  Most Read  //  Most Downloaded  //  Most Cited
Aging and disease    2019, Vol. 10 Issue (2) : 231-248     DOI: 10.14336/AD.2018.0510
Original Article |
Involvement of the MiR-181b-5p/HMGB1 Pathway in Ang II-induced Phenotypic Transformation of Smooth Muscle Cells in Hypertension
Feng-Juan Li1, Cheng-Long Zhang1, Xiu-Ju Luo2, Jun Peng3,4,*, Tian-Lun Yang1,*
1Department of Cardiovascular Medicine, Xiangya Hospital, Central South University, Changsha 410008, China.
2Department of Laboratory Medicine, Xiangya School of Medicine, Central South University, Changsha410013, China.
3Department of Pharmacology, Xiangya School of Pharmaceutical Sciences, Central South University, Changsha, China.
4Hunan Provincial Key Laboratory of Cardiovascular Research, Xiangya School of Pharmaceutical Sciences, Central South University, Changsha 410078, China
Download: PDF(1922 KB)   HTML
Export: BibTeX | EndNote | Reference Manager | ProCite | RefWorks    
Abstract  

Phenotypic transformation of vascular smooth muscle cells (VSMCs) contributes to vascular remodeling in hypertension. High mobility group box-1 (HMGB1) has been reported to be involved in several pathogenic processes including VSMC proliferation and migration. The present study was designed to determine the role of HMGB1 in VSMC phenotypic transformation in hypertension. First, we demonstrated that HMGB1 was elevated in a model of Ang II-induced VSMC phenotypic transformation, which showed down-regulation of contractile proteins and up-regulation of synthetic proteins. Knockdown of HMGB1 and losartan could block the phenotypic transformation. Next, we identified three potential miRNAs for upstream regulation of HMGB1 by bioinformatic analysis; only miR-181b-5p was significantly down-regulated in Ang II-treated cells. Co-treating the cells with miR-181b-5p mimics suppressed HMGB1 expression as well as the phenotypic transformation, migration, and proliferation. Furthermore, the luciferase reporter gene assay confirmed the direct interaction between miR-181b-5p and HMGB1. Finally, to extend these cell-based studies to clinical patients, we demonstrated that plasma miR-181b-5p levels were decreased, while Ang II and HMGB1 levels, as well as the intima-media thickness (IMT) were increased in hypertensive patients; these effects were reversed following the administration of angiotensin receptor blockers. Based on these observations, we conclude that the down-regulation of miR-181b-5p leads to the elevation of HMGB1 levels in hypertensive patients, which accounts, at least partially, for VSMCs phenotypic transformation and vascular remodeling. Our findings also highlight that the plasma levels of miR-181b-5p and HMGB1 may serve as novel biomarkers for vascular remodeling in the hypertensive patients.

Keywords HMGB1      hypertension      phenotypic transformation      miR-181b-5p     
Corresponding Authors: Peng Jun,Yang Tian-Lun   
About author:

Currently address: Department of Neurology, Zhongshan Hospital, Fudan University, Shanghai, China

Issue Date: 09 March 2018
Service
E-mail this article
E-mail Alert
RSS
Articles by authors
Feng-Juan Li
Cheng-Long Zhang
Xiu-Ju Luo
Jun Peng
Tian-Lun Yang
Cite this article:   
Feng-Juan Li,Cheng-Long Zhang,Xiu-Ju Luo, et al. Involvement of the MiR-181b-5p/HMGB1 Pathway in Ang II-induced Phenotypic Transformation of Smooth Muscle Cells in Hypertension[J]. Aging and disease, 2019, 10(2): 231-248.
URL:  
http://www.aginganddisease.org/EN/10.14336/AD.2018.0510     OR     http://www.aginganddisease.org/EN/Y2019/V10/I2/231
Product NumberProtein NameDilution ratioManufacturers
ab79823HMGB11:10000abcam, USA
ab32575α-SMA1:1000abcam, USA
ab14106SM22α1:1000abcam, USA
ab91655OPN1:5000abcam, USA
A531GAPDH1:10000Bioworld, USA
Table 1  The primary antibodies for Western Blot.
GeneForward (F) and reverse (R)
GAPDHF:5'-TGATGACATCAAGAAGGTGGTGAAG
R:3'-TCCTTGGAGGCCATGTGGGCCAT
α-SMAF:5'- AGCGTGGCTACCCTTCGTGAC
R:3'-GCTCGTTGCCGATGGTGATGAC
SM22αF:5'-GAATGGCGTGATTCTGAGC
R:3'-CTCCATCTGCTTGAAGAC
OPNF:5'- TGAGTCTGGAAATAACTAATGTGTTTGA
R:3'-GAACATAGACATAACCCTGAAGCTTTT
HMGB1
HMGB1_mut HMGB1-3’UTR
F:5'-CACTGGGCGACTCTGTGCCTCG
R:3'-CGGGCCTTGTCCGCTTTTGCCA F:5'-AGACCTGACTTACATCCCCAAAAGCGTGA GCT R:3'-TTTGGGGATGTAAGTCAGGTCTTCTTTAA TGT F:5'-GCGGCTCGAGATCAATCTACTCAAAGCAT R:3'-AATGCGGCCGCAACTCCTAAGCAGATA AAC
Table 2  Human Primer sequences for quantitative real-time PCR.
miRNASequenceNumber
hsa-miR-103a-3pAGCAGCAUUGUACAGGGCUAUGAMIMAT0000101
hsa-miR-107AGCAGCAUUGUACAGGGCUAUCAMIMAT0000104
hsa-miR-181b-5pAACAUUCAUUGCUGUCGGUGGGUMIMAT0000257
Table 3  The miRNA sequences and miRBase accession numbers.
Figure 1.  Up-regulation of high-mobility group box 1 (HMGB1) in angiotensin (Ang) II-induced human aortic vascular smooth muscle cell (HAVSMC) phenotype transformation

A-D) mRNA levels of α-smooth muscle actin (α-SMA), smooth muscle 22α (SM22α), osteopontin (OPN), and HMGB1 in HAVSMCs, respectively. E) representative images of western blot analysis for HMGB1, α-SMA, SM22α, OPN, and GAPDH. F-I) Protein levels of α-SMA, SM22α, OPN, and HMGB1, respectively. Arbitrary optical density units of the target proteins were normalized to GAPDH and expressed as fold change. J. Protein levels of HMGB1 in culture medium *P <0.05, **P <0.01 vs. control group; #P <0.05, ##P <0.01 vs. Ang II group. At least three independent experiments were performed for each group.

Figure 2.  HMGB1 silencing inhibited Ang II-induced HAVSMC phenotype transformation

A) Representative images of western blot analysis for HMGB1, α-SMA, SM22α, OPN, and GAPDH. B-E) Protein levels of HMGB1, α-SMA, SM22α, and OPN, respectively. Arbitrary optical density units of the target proteins were normalized to GAPDH and expressed as fold change. *P <0.05, **P <0.01 vs. control group; #P <0.05, ##P <0.01 vs. the Ang II group. At least three independent experiments were performed for each group.

Figure 3.  HMGB1 silencing inhibited HAVSMC migration, proliferation, and cell viability

A) Representative images of scratch-wound healing assay (100×). B) Representative images of Transwell assay (100×). C) Representative images of Edu assay (100×). D) HAVSMC migration distance in each group. E. The number of migrated HAVSMCs in each group. F) The percentage of Edu-positive cells in each group. G. Cell viability in each group. *P <0.05, **P <0.01 vs. the control group; #P <0.05, ##P <0.01 vs. the Ang II group. At least three independent experiments were performed for each group.

Figure 4.  Putative binding sites of miR-181b-5p in the HMGB1 3′-UTR

A and B) The three putative miRNA binding sites in the HMGB1 3′-UTR predicted by target scan analysis. C) Conserved putative target sites of HMGB1 in humans. D) Expression of the putative miRNAs in HAVSMCs. **P <0.01 vs. the control group; ##P <0.01 vs. the Ang II group. At least three independent experiments were performed for each group.

Figure 5.  Overexpression miR-181b-5p reversed Ang II-induced HAVSMC phenotype transformation

A. HMGB1 mRNA expression in each group. B. Representative images of western blot analysis for HMGB1, α-SMA, SM22α, OPN, and GAPDH. C. Protein levels of HMGB1 in culture medium. D-G. Protein levels of HMGB1, α-SMA, SM22α, and OPN, respectively. Arbitrary optical density units of the target proteins were normalized to GAPDH and expressed as fold change. *P <0.05, **P <0.01 vs. the control group; #P <0.05, ##P <0.01 vs. the Ang II group. At least three independent experiments were performed for each group.

Figure 6.  Overexpression miR-181b-5p inhibited HAVSMC migration, proliferation, and cell viability

A) Representative images of scratch-wound healing assay (100×). B) Representative images of Transwell assay (100×). C. Representative images of Edu assay (100×). D) HAVSMC migration distance in each group. E) The number of migrated HAVSMCs in each group. F) The percentage of Edu-positive cells in each group. G) Cell viability in each group. *P <0.05, **P <0.01 vs. the control group; #P <0.05, ##P <0.01 vs. the Ang II group. At least three independent experiments were performed for each group.

Figure 7.  Transcriptional effect of the miR-181b-5p mimic on the 3′-UTR of HMGB1 in HAVSMCs

A) The 3′-UTR of wild type (WT) HMGB1 (the potential binding site for miR-181-5p is indicated in bold letters). B) The 3′-UTR of the mutated (MUT) HMGB1 (the MUT miR-181-5p binding site is indicated in bold letters). C) Luciferase activity in HAVSMCs in the presence of the miR-181b-5p mimic. At least three independent experiments were performed for each group.

Figure 8.  Correlation between HMGB1plasma levels and blood pressure

A and B) Subject blood pressure. C HMGB1plasma levels. D and E) Correlation between HMGB1 plasma levels of and blood pressure. Control group, n=58; hypertension group, n=51; +ARB treatment group, n=71. **P <0.01 vs. control, ##P <0.01 vs. hypertension.

Control
(n=58)
Hypertension
(n=53)
+ARB
(n=71)
Age, yrs59.28±1.4760.83±1.4361.48±1.32
Male (% of total)29(15.9%)27(14.8%)34(18.7%)
Female (% of total)29(15.9%)26(14.3%)37(20.7%)
SBP(mmHg)124.36±2.48146.42±2.78**137.35±1.98##
DBP(mmHg)74.24±1.3582.04±1.51**75.54±1.32##
FBG, mmol/L5.49±0.075.53±0.085.50±0.08
TG, mmol/L1.46±0.081.50±0.801.56±0.08
TC, mmol/L5.14±0.115.31±0.105.33±0.08
HDL, mmol/L1.38±0.041.27±0.051.35±0.05
LDL, mmol/L3.09±0.122.64±0.112.84±0.29
ALT, U/L26.02±1.5526.35±2.4826.99±2.38
AST, U/L22.50±1.0222.99±1.1123.60±1.17
BUN, mmol/L5.24±0.175.29±0.215.62±0.14
UA, mmol/L348.97±11.53349.92±12.90355.41±11.26
Cr, μmol/L84.07±1.2285.19±1.0785.75±0.81
Table 4  Baseline characteristics of participants.
Figure 9.  Correlation between miR-181b-5p, HMGB1, Ang II, and intima-media thickness (IMT) in hypertensive patients

A) miR-181b-5p plasma levels. B) Ang II plasma levels. C. IMT values, determined by carotid artery ultrasound. D) The correlation between HMGB1 level and miR-181b-5p level. E) The correlation between HMGB1 level and Ang II level. E) The correlation between IMT and Ang II level. F) The correlation between IMT and HMGB1 level. Control group, n=58; Hypertension group, n=51, Hypertension +ARB group, n=71. **P <0.01 vs. control, ##P <0.01 vs. Hypertension.

[1] Mills KT, Bundy JD, Kelly TN, Reed JE, Kearney PM, Reynolds K, et al. (2016). Global Disparities of Hypertension Prevalence and Control: A Systematic Analysis of Population-Based Studies From 90 Countries. Circulation, 134:441-450.
[2] Li W, Gu H, Teo KK, Bo J, Wang Y, Yang J, et al. (2016). Hypertension prevalence, awareness, treatment, and control in 115 rural and urban communities involving 47000 people from China. Journal of Hypertension, 34:39-46.
[3] Lewington S, Lacey B, Clarke R, Guo Y, Kong XL, Yang L, et al. (2016). The Burden of Hypertension and Associated Risk for Cardiovascular Mortality in China. JAMA Intern Med, 176:524-532.
[4] Chen WW, Gao RL, Liu LS, Zhu ML, Wang W, Wang YJ, et al. (2017). China cardiovascular diseases report 2015: a summary. J Geriatr Cardiol, 14:1-10.
[5] Hernanz R, Martinez-Revelles S, Palacios R, Martin A, Cachofeiro V, Aguado A, et al. (2015). Toll-like receptor 4 contributes to vascular remodelling and endothelial dysfunction in angiotensin II-induced hypertension. Br J Pharmacol, 172:3159-3176.
[6] Wu X, Fan R (2017). Identifications of potential therapeutic targets and drugs in angiotensin II-induced hypertension. Medicine (Baltimore), 96:e8501.
[7] Muñoz-Durango N, Fuentes C, Castillo A, González-Gómez L, Vecchiola A, Fardella C, et al. (2016). Role of the Renin-Angiotensin-Aldosterone System beyond Blood Pressure Regulation: Molecular and Cellular Mechanisms Involved in End-Organ Damage during Arterial Hypertension. International Journal of Molecular Sciences, 17:797.
[8] Schiffrin EL (2012). Vascular remodeling in hypertension: mechanisms and treatment. Hypertension, 59:367-374.
[9] Lu Y, Zhang L, Liao X, Sangwung P, Prosdocimo DA, Zhou G, et al. (2013). Kruppel-like factor 15 is critical for vascular inflammation. J Clin Invest, 123:4232-4241.
[10] Davis-Dusenbery BN, Wu C, Hata A (2011). Micromanaging vascular smooth muscle cell differentiation and phenotypic modulation. Arterioscler Thromb Vasc Biol, 31:2370-2377.
[11] Lacolley P, Regnault V, Nicoletti A, Li Z, Michel JB (2012). The vascular smooth muscle cell in arterial pathology: a cell that can take on multiple roles. Cardiovasc Res, 95:194-204.
[12] Shi N, Chen SY (2014). Mechanisms simultaneously regulate smooth muscle proliferation and differentiation. J Biomed Res, 28:40-46.
[13] Gomolak JR, Didion SP (2014). A role for innate immunity in the development of hypertension. Med Hypotheses, 83:640-643.
[14] Caillon A, Schiffrin EL (2016). Role of Inflammation and Immunity in Hypertension: Recent Epidemiological, Laboratory, and Clinical Evidence. Curr Hypertens Rep, 18:21.
[15] Marchesi C, Paradis P, Schiffrin EL (2008). Role of the renin-angiotensin system in vascular inflammation. Trends Pharmacol Sci, 29:367-374.
[16] Zhou C, Huang J, Chen J, Lai J, Zhu F, Xu X, et al. (2016). CYP2J2-Derived EETs Attenuated Angiotensin II-Induced Adventitial Remodeling via Reduced Inflammatory Response. Cell Physiol Biochem, 39:721-739.
[17] Meng Y, Chen C, Tian C, Du J, Li HH (2015). Angiotensin II-induced Egr-1 expression is suppressed by peroxisome proliferator-activated receptor-gamma ligand 15d-PGJ(2) in macrophages. Cell Physiol Biochem, 35:689-698.
[18] Scaffidi P, Misteli T, Bianchi ME (2002). Release of chromatin protein HMGB1 by necrotic cells triggers inflammation. Nature, 418:191-195.
[19] Li W, Sama AE, Wang H (2006). Role of HMGB1 in cardiovascular diseases. Current Opinion in Pharmacology, 6:130.
[20] Lange SS, Mitchell DL, Vasquez KM (2008). High mobility group protein B1 enhances DNA repair and chromatin modification after DNA damage. Proc Natl Acad Sci U S A, 105:10320-10325.
[21] Porto A, Palumbo R, Pieroni M, Aprigliano G, Chiesa R, Sanvito F, et al. (2006). Smooth muscle cells in human atherosclerotic plaques secrete and proliferate in response to high mobility group box 1 protein. FASEB J, 20:2565-2566.
[22] Yang J, Chen L, Yang J, Ding J, Rong H, Dong W, et al. (2012). High mobility group box-1 induces migration of vascular smooth muscle cells via TLR4-dependent PI3K/Akt pathway activation. Mol Biol Rep, 39:3361-3367.
[23] Yang J, Chen L, Ding J, Fan Z, Li S, Wu H, et al. (2016). MicroRNA-24 inhibits high glucose-induced vascular smooth muscle cell proliferation and migration by targeting HMGB1. Gene, 586:268-273.
[24] Neth P, Nazari-Jahantigh M, Schober A, Weber C (2013). MicroRNAs in flow-dependent vascular remodelling. Cardiovasc Res, 99:294-303.
[25] Wang H, Jiang M, Xu Z, Huang H, Gong P, Zhu H, et al. (2015). miR-146b-5p promotes VSMC proliferation and migration. Int J Clin Exp Pathol, 8:12901-12907.
[26] Hartmann P, Schober A, Weber C (2015). Chemokines and microRNAs in atherosclerosis. Cell Mol Life Sci, 72:3253-3266.
[27] Pahl MC, Kimberly D, Gabor G, Irene H, Elmore JR, Schworer CM, et al. (2012). MicroRNA expression signature in human abdominal aortic aneurysms. Bmc Medical Genomics, 5:25.
[28] Sun HJ, Liu TY, Zhang F, Xiong XQ, Wang JJ, Chen Q, et al. (2015). Salusin-beta contributes to vascular remodeling associated with hypertension via promoting vascular smooth muscle cell proliferation and vascular fibrosis. Biochim Biophys Acta, 1852:1709-1718.
[29] Perge P, Decmann A, Pezzani R, Bancos I, Fassina A, Luconi M, et al. (2018). Analysis of circulating extracellular vesicle-associated microRNAs in cortisol-producing adrenocortical tumors. Endocrine, 59:280-287.
[30] Calhoun DA, White WB, Krum H, Guo W, Bermann G, Trapani A, et al. (2011). Effects of a novel aldosterone synthase inhibitor for treatment of primary hypertension: results of a randomized, double-blind, placebo- and active-controlled phase 2 trial. Circulation, 124:1945-1955.
[31] Zhang L, Xie P, Wang J, Yang Q, Fang C, Zhou S, et al. (2010). Impaired peroxisome proliferator-activated receptor-gamma contributes to phenotypic modulation of vascular smooth muscle cells during hypertension. J Biol Chem, 285:13666-13677.
[32] Doran AC, Meller N, McNamara CA (2008). Role of smooth muscle cells in the initiation and early progression of atherosclerosis. Arterioscler Thromb Vasc Biol, 28:812-819.
[33] Tamura K, Kanaoka T, Kobayashi R, Ohki K, Ohsawa M (2015). TLR4 as a possible key regulator of pathological vascular remodeling by Ang II receptor activation. Hypertens Res, 38:642-643.
[34] Ren XS, Tong Y, Ling L, Chen D, Sun HJ, Zhou H, et al. (2017). NLRP3 Gene Deletion Attenuates Angiotensin II-Induced Phenotypic Transformation of Vascular Smooth Muscle Cells and Vascular Remodeling. Cell Physiol Biochem, 44:2269-2280.
[35] Savoia C, Burger D, Nishigaki N, Montezano A, Touyz RM (2011). Angiotensin II and the vascular phenotype in hypertension. Expert Rev Mol Med, 13:e11.
[36] Te Riet L, van Esch JH, Roks AJ, van den Meiracker AH, Danser AH (2015). Hypertension: renin-angiotensin-aldosterone system alterations. Circ Res, 116:960-975.
[37] Dange RB, Agarwal D, Teruyama R, Francis J (2015). Toll-like receptor 4 inhibition within the paraventricular nucleus attenuates blood pressure and inflammatory response in a genetic model of hypertension. J Neuroinflammation, 12:31.
[38] Mitchell GF (2014). Arterial stiffness and hypertension: chicken or egg? Hypertension, 64:210-214.
[39] Siti HN, Kamisah Y, Kamsiah J (2015). The role of oxidative stress, antioxidants and vascular inflammation in cardiovascular disease (a review). Vascul Pharmacol, 71:40-56.
[40] Jia D, He Y, Zhu Q, Liu H, Zuo C, Chen G, et al. (2017). RAGE-mediated extracellular matrix proteins accumulation exacerbates HySu-induced pulmonary hypertension. Cardiovasc Res, 113:586-597.
[41] Wang M, Kim SH, Monticone RE, Lakatta EG (2015). Matrix metalloproteinases promote arterial remodeling in aging, hypertension, and atherosclerosis. Hypertension, 65:698-703.
[42] Nogueira-Ferreira R, Ferreira-Pinto MJ, Silva AF, Vitorino R, Justino J, Costa R, et al. (2017). HMGB1 down-regulation mediates terameprocol vascular anti-proliferative effect in experimental pulmonary hypertension. J Cell Physiol, 232:3128-3138.
[43] Huang YY, Su W, Zhu ZW, Tang L, Hu XQ, Zhou SH, et al. (2016). Elevated serum HMGB1 in pulmonary arterial hypertension secondary to congenital heart disease. Vascul Pharmacol, 85:66-72.
[44] Li WJ, Hu K, Yang JP, Xu XY, Li N, Wen ZP, et al. (2017). HMGB1 affects the development of pulmonary arterial hypertension via RAGE. Eur Rev Med Pharmacol Sci, 21:3950-3958.
[1] Maeso-Díaz Raquel, Ortega-Ribera Martí, Lafoz Erica, Lozano Juan José, Baiges Anna, Francés Rubén, Albillos Agustín, Peralta Carmen, García-Pagán Juan Carlos, Bosch Jaime, Cogger Victoria C, Gracia-Sancho Jordi. Aging Influences Hepatic Microvascular Biology and Liver Fibrosis in Advanced Chronic Liver Disease[J]. Aging and disease, 2019, 10(4): 684-698.
[2] Li Tangzhiming, Zha Lihuang, Luo Hui, Li Suqi, Zhao Lin, He Jingni, Li Xiaohui, Qi Qiangqiang, Liu Yuwei, Yu Zaixin. Galectin-3 Mediates Endothelial-to-Mesenchymal Transition in Pulmonary Arterial Hypertension[J]. Aging and disease, 2019, 10(4): 731-745.
[3] Han Rongrong, Liu Zeyue, Sun Nannan, Liu Shu, Li Lanlan, Shen Yan, Xiu Jianbo, Xu Qi. BDNF Alleviates Neuroinflammation in the Hippocampus of Type 1 Diabetic Mice via Blocking the Aberrant HMGB1/RAGE/NF-κB Pathway[J]. Aging and disease, 2019, 10(3): 611-625.
[4] Zgheib Nathalie K, Sleiman Fatima, Nasreddine Lara, Nasrallah Mona, Nakhoul Nancy, Isma’eel Hussain, Tamim Hani. Short Telomere Length is Associated with Aging, Central Obesity, Poor Sleep and Hypertension in Lebanese Individuals[J]. Aging and disease, 2018, 9(1): 77-89.
[5] Peng Sheng, Shen Ting, Liu Jie, Tomlinson Brian, Sun Huimin, Chen Xiaoli, Chan Paul, Kuang YaShu, Zheng Liang, Wu Hong, Ding Xugang, Qian Dingguang, Shen Yixin, Gao Pingjin, Fan Huimin, Liu Zhongmin, Zhang Yuzhen. Uncontrolled Hypertension Increases with Age in an Older Community-Dwelling Chinese Population in Shanghai[J]. Aging and disease, 2017, 8(5): 558-569.
[6] Dai Chuan-Fang, Xie* Xiang, Ma* Yi-Tong, Yang Yi-Ning, Li Xiao-Mei, Fu Zhen-Yan, Liu Fen, Chen Bang-Dang, Gai Min-Tao. Relationship between CYP17A1 Genetic Polymorphism and Essential Hypertension in a Chinese Population[J]. Aging and disease, 2015, 6(6): 486-498.
Viewed
Full text


Abstract

Cited

  Shared   
Copyright © 2014 Aging and Disease, All Rights Reserved.
Address: Aging and Disease Editorial Office 3400 Camp Bowie Boulevard Fort Worth, TX76106 USA
Fax: (817) 735-0408 E-mail: editorial@aginganddisease.org
Powered by Beijing Magtech Co. Ltd