Please wait a minute...
 Home  About the Journal Editorial Board Aims & Scope Peer Review Policy Subscription Contact us
 
Early Edition  //  Current Issue  //  Open Special Issues  //  Archives  //  Most Read  //  Most Downloaded  //  Most Cited
Aging and disease    2019, Vol. 10 Issue (3) : 578-591     DOI: 10.14336/AD.2018.0604
Orginal Article |
Longevity Effect of Liuwei Dihuang in Both Caenorhabditis Elegans and Aged Mice
Weidong Chen1, Jinzeng Wang1, Jiahao Shi1, Xu Yang3, Ping Yang4, Ning Wang1, Sai Yang1, Tianpei Xie5, Hua Yang1, Mengjie Zhang1, Haiyun Wang1,*, Jian Fei1,2,*
1School of Life Science and Technology, Tongji University, Shanghai 200092, China
2Shenqi Institute for Ethnomedicine, Tongji University, Shanghai 200092, China
3School of Medicine, Tongji University, Shanghai 200092, China
4Shanghai Engineering Research Center for Model Organisms, SRMOC/SMOC, Shanghai 201203, China
5Standard Testing Lab (Shanghai) Co., Ltd., Pudong, Shanghai 201203, China
Download: PDF(1322 KB)   HTML
Export: BibTeX | EndNote | Reference Manager | ProCite | RefWorks    
Abstract  

Liuwei Dihuang (LWDH), a famous traditional Chinese medicine, is widely used in the clinical treatment of aging-related diseases in China. However, its pharmacological mechanisms are not clear. In the present study, we evaluated the lifespan extension effect of LWDH in C. elegans and mice and revealed its underlying mechanisms. The results showed that LWDH significantly extended the lifespan of C. elegans in a dose-dependent manner. LWDH also conferred protection to nematodes against oxidative stress and reduced their fat storage. Genetics analysis and microarray data showed that the longevity effect of LWDH was attributed to the regulation of the innate immune response, proteolysis, lipid metabolism, and the oxidation-reduction process and was dependent on daf-16. Among the six herbs in the formula, Radix Rehmanniae Preparata and Fructus Macrocarpii contributed most to the longevity effect of this medicine, while the other four components had a synergistic effect on the longevity effect of the prescription. The lack of any single herb reduced the efficacy of the complete formula. LWDH also extended the lifespan and reduced both the weight and oxidant stress status in aged mice. Taken together, these results suggested that LWDH might function in a multi-target manner to extend the lifespan in both C. elegans and aged mice, and the best effect was achieved with the complete formula.

Keywords traditional Chinese medicine      lifespan      model organisms      microarray      signal pathway     
Corresponding Authors: Wang Haiyun,Fei Jian   
About author:

These authors contributed equally to this study.

Just Accepted Date: 21 August 2018   Online First Date: 21 August 2018    Issue Date: 28 May 2019
Service
E-mail this article
E-mail Alert
RSS
Articles by authors
Weidong Chen
Jinzeng Wang
Jiahao Shi
Xu Yang
Ping Yang
Ning Wang
Sai Yang
Tianpei Xie
Hua Yang
Mengjie Zhang
Haiyun Wang
Jian Fei
Cite this article:   
Weidong Chen,Jinzeng Wang,Jiahao Shi, et al. Longevity Effect of Liuwei Dihuang in Both Caenorhabditis Elegans and Aged Mice[J]. Aging and disease, 2019, 10(3): 578-591.
URL:  
http://www.aginganddisease.org/EN/10.14336/AD.2018.0604     OR     http://www.aginganddisease.org/EN/Y2019/V10/I3/578
GeneForward SequenceReverse Sequence
sea-1ATTGAGAAGAGCCGGAAGCCTGACACCGTCACGAATGAGG
skr-9TCGACTTGATCGTTGCCTGTCTGCGTCCTTGTCGGTGAT
ctl-2TCCCAGATGGGTACCGTCATGGTCCGAAGAGGCAAGTTGA
F42A10.6TACCAACGGAGTACCATGCCCTTCCTTGCTCGGGTCATCA
cpr-1AGACTACCACGGAGCTGGATTTGGAACAGCGTAGGCAGAG
ugt-41TGCGATCTGCCTTGCATAGTTACTATCTTGTGCCGGCTGC
nhr-68GTAGGAATGGACAAGACTCCCGAAGAGGAGATAACTG
dod-3GTGCATATTGTGGAGCTGCGGTACTTGCACGCTGCGAAAA
lipl-4CTCAAAAAGTGTCGATCTTGAGTTGATGAGGTGAATTGGCGACC
vit-5TCTGGACTCCCAACCGCAATTTGAGCACGGAATGGAAGC
sod-3ATCTACTGCTCGCACTGCTTTGTTCACGTAGGTGGCATGA
mtl-1TGTGAGGAGGCCAGTGAGATTAATGAGCCGCAGCAGTT
act-4GCCACCGCTGCCTCCTCATCCCGGCAGACTCCATACCCAAGAAG
Table 1  List of the primers used in the present study.
TreatmentMean life span
± SEM (days)
Percentage changeNumber of animalsP value
Control20.41 ± 1.010-58-
LWDH-0.5 mg/ml23.74 ± 0.855916.30%540.061
LWDH-1 mg/ml26.97 ± 1.03132.09%58< 0.001 (***)
LWDH-1.5 mg/ml28.98 ± 1.32141.98%59< 0.001 (***)
LWDH-2 mg/ml29.84 ± 1.54946.19%51< 0.001 (***)
LWDH-3 mg/ml26.85 ± 2.49631.53%40< 0.001 (***)
LWDH-5 mg/ml7.368 ± 1.157-63.90%57< 0.001 (***)
LWDH-10 mg/ml3.393 ± 0.2096-83.38%56< 0.001 (***)
50 μM Mianserin29.06 ± 0.910742.35%51< 0.001 (***)
Table 2  LWDH extended the lifespan of C. elegans at different concentrations.
Figure 1.  LWDH extended the lifespan of wild-type <i>C. elegans</i> at different concentrations

LWDH at different concentrations or 50 μM mianserin (positive control) were added into the medium on the first day of adulthood. The survival of worms was monitored every two days until all of the worms were dead.

Figure 2.  LWDH improved the resistance of <i>C. elegans</i> against stress

Worms were pretreated with 1 mg/ml LWDH or not for five days. Subsequently, the worms were subjected to oxidative and heat stress. For oxidative stress, the worms were exposed to 50 mM paraquat (A) or 10 mM K2Cr2O7 (B), and for heat stress, the worms were transferred from 20 °C to 35 °C (C). The statistical significance between curves with different time points was calculated by two-way ANOVA. (D-F) LT50 was calculated and compared between worms pretreated with LWDH or not.

Figure 3.  LWDH decreased the fat storage in C. elegans. Fat storage was measured with Nile Red after a five-day treatment in the absence (A) or presence (B) of LWDH. (C) Statistical comparisons between the two groups. (D) Relative expression levels of lipl-4 on day 5 after LWDH treatment.
Figure 4.  The effects of LWDH in aging-related mutants

eat-2(ad465) (A), daf-2(e1370) (B), daf-16(mu86) (C) and wild-type N2 were treated with 1 mg/ml LWDH or not on the first day of adulthood to evaluate the effect of lifespan extension.

Figure 5.  LWDH promoted DAF-16 nuclear localization

Representative images for the localization phenotype of DAF-16::GFP in transgenic TJ356 strain after a ten-day treatment in the absence (A) or presence (B) of LWDH, and the worms maintained at 35 °C for 2 h were regarded as the positive control (C). The GFP fluorescence intensity (D) and the number of DAF-16::GFP particles (E) were measured according to the images.

Figure 6.  LWDH extended the lifespan of <i>C. elegans</i> in a multi-target manner

(A) The symbol of C and D in the group names represented worms treated with the absence (control) or presence (1 mg/ml) of LWDH, respectively. Days 10 and 22 of adulthood were represented as 10 and 22, respectively. DEGs were analyzed between groups, and numbers of up- or downregulated genes were provided. (B) GO analysis was performed with the downregulated genes in C22 vs. C10 and terms of biological process (BP) were shown. (C) The heat map showed the expression pattern of DEGs from C22 vs. C10 and D22 vs. C22. Red denoted higher expression level, and green denoted lower expression level. (D) Dynamic expression pattern of DEGs from C22 vs. C10 and D22 vs. C22, and genes were classified into 8 clusters. Numbers on top left corner indicated the cluster number. Numbers on bottom left corner indicated the number of DEGs. The colored clusters (1, 2 and 6) indicated significantly enriched ones by DEGs (P < 0.05). (E) GO analysis showed the BP terms of DEGs from cluster 2.

Figure 7.  The effects of individual herbs and formulas lacking one herb in wild-type <i>C. elegans</i>

The complete formula, each individual herb (the first six graphs) or formulas consisting of five herbs (the rest ones, herb with (-) at the end represented its lacking in the formula) were added to the medium on the first day of adulthood. Black lines represented the control group, red lines represented the complete formula, and green lines represented the individual herbs or formulas used. The survival of the worms was monitored every two days until all of the worms were dead.

Figure 8.  LWDH extended the lifespan of aged mice

(A) Mice that were 22-23 months old were treated with different doses of LWDH. Day 1 represented the first day of taking LWDH. n = 9, 7, and 10 in control, low-dose and high-dose group, respectively. (B) Body weight was measured three times a week and compared between the different groups or between the first and last week in the same group. (C, D) The 21-month-old mice were treated with the low dose of LWDH. Serum SOD and MDA were measured after a 12-week treatment. n = 8 in each group.

[1] Perry B, Zhang J, Saleh T, Wang Y (2014). Liuwei Dihuang, a traditional Chinese herbal formula, suppresses chronic inflammation and oxidative stress in obese rats. J Integr Med, 12:447-454.
[2] Lee, Kwang-Sik, Lim, Baek-Vin, Chang, Hyun-Kyung, et al. (2005). Liuweidihuang-tang improves spatial memory function and increases neurogenesis in the dentate gyrus in rats. Fitoterapia, 76:514-519.
[3] Huang Y, Zhang H, Yang S, Qiao H, Zhou W, Zhang Y (2012). Liuwei Dihuang decoction facilitates the induction of long-term potentiation (LTP) in senescence accelerated mouse/prone 8 (SAMP8) hippocampal slices by inhibiting voltage-dependent calcium channels (VDCCs) and promoting N-methyl-d-aspartate receptor (NMDA) receptors. J Ethnopharmacol, 140:384-390.
[4] Zhao Y, Yu J, Liu J, An X (2016). The Role of Liuwei Dihuang Pills and Ginkgo Leaf Tablets in Treating Diabetic Complications. Evid Based Complement Alternat Med, 2016:7931314.
[5] Dai B, Wu Q, Zeng C, Zhang J, Cao L, Xiao Z, et al. (2016). The effect of Liuwei Dihuang decoction on PI3K/Akt signaling pathway in liver of type 2 diabetes mellitus (T2DM) rats with insulin resistance. J Ethnopharmacol, 192:382-389.
[6] Tseng YT, Chang FR, Lo YC (2014). The Chinese herbal formula Liuwei dihuang protects dopaminergic neurons against Parkinson’s toxin through enhancing antioxidative defense and preventing apoptotic death. Phytomedicine, 21:724-733.
[7] Wan F, Zhi D, Liu D, Xian J, Li M, AbuLizi A, et al. (2014). Lifespan extension in Caenorhabiditis elegans by several traditional Chinese medicine formulas. Biogerontology, 15:377-387.
[8] Brenner S (1974). The genetics of Caenorhabditis elegans. Genetics, 77:71-94.
[9] Dorman JB, Albinder B, Shroyer T, Kenyon C (1995). The age-1 and daf-2 genes function in a common pathway to control the lifespan of Caenorhabditis elegans. Genetics, 141:1399-1406.
[10] Tatar M, Bartke A, Antebi A (2003). The endocrine regulation of aging by insulin-like signals. Science, 299:1346-1351.
[11] Petrascheck M, Ye X, Buck LB (2007). An antidepressant that extends lifespan in adult Caenorhabditis elegans. Nature, 450:553-556.
[12] Honda Y, Fujita Y, Maruyama H, Araki Y, Ichihara K, Sato A, et al. (2011). Lifespan-extending effects of royal jelly and its related substances on the nematode Caenorhabditis elegans. PLoS One, 6:e23527.
[13] Wilson MA, Shukitt-Hale B, Kalt W, Ingram DK, Joseph JA, Wolkow CA (2006). Blueberry polyphenols increase lifespan and thermotolerance in Caenorhabditis elegans. Aging Cell, 5:59-68.
[14] Golegaonkar S, Tabrez SS, Pandit A, Sethurathinam S, Jagadeeshaprasad MG, Bansode S, et al. (2015). Rifampicin reduces advanced glycation end products and activates DAF-16 to increase lifespan in Caenorhabditis elegans. Aging Cell, 14:463-473.
[15] Solis GM, Petrascheck M (2011). Measuring Caenorhabditis elegans life span in 96 well microtiter plates. J Vis Exp.
[16] Voisine C, Varma H, Walker N, Bates EA, Stockwell BR, Hart AC (2007). Identification of potential therapeutic drugs for huntington’s disease using Caenorhabditis elegans. PLoS One, 2:e504.
[17] Yang P, Sun R, Yao M, Chen W, Wang Z, Fei J (2013). A C-terminal truncated mutation of spr-3 gene extends lifespan in Caenorhabditis elegans. Acta Biochim Biophys Sin (Shanghai), 45:540-548.
[18] Eisen MB, Spellman PT, Brown PO, Botstein D (1998). Cluster analysis and display of genome-wide expression patterns. Proc Natl Acad Sci U S A, 95:14863-14868.
[19] Ernst J, Bar-Joseph Z (2006). STEM: a tool for the analysis of short time series gene expression data. BMC Bioinformatics, 7:191.
[20] Cai WJ, Huang JH, Zhang SQ, Wu B, Kapahi P, Zhang XM, et al. (2011). Icariin and its derivative icariside II extend healthspan via insulin/IGF-1 pathway in C. elegans. PLoS One, 6:e28835.
[21] Canuelo A, Gilbert-Lopez B, Pacheco-Linan P, Martinez-Lara E, Siles E, Miranda-Vizuete A (2012). Tyrosol, a main phenol present in extra virgin olive oil, increases lifespan and stress resistance in Caenorhabditis elegans. Mech Ageing Dev, 133:563-574.
[22] Wang MC, O’Rourke EJ, Ruvkun G (2008). Fat metabolism links germline stem cells and longevity in C. elegans. Science, 322:957-960.
[23] Lakowski B, Hekimi S (1998). The genetics of caloric restriction in Caenorhabditis elegans. Proc Natl Acad Sci U S A, 95:13091-13096.
[24] McKay JP, Raizen DM, Gottschalk A, Schafer WR, Avery L (2004). eat-2 and eat-18 are required for nicotinic neurotransmission in the Caenorhabditis elegans pharynx. Genetics, 166:161-169.
[25] Kimura KD, Tissenbaum HA, Liu Y, Ruvkun G (1997). daf-2, an insulin receptor-like gene that regulates longevity and diapause in Caenorhabditis elegans. Science, 277:942-946.
[26] Greer EL, Dowlatshahi D, Banko MR, Villen J, Hoang K, Blanchard D, et al. (2007). An AMPK-FOXO pathway mediates longevity induced by a novel method of dietary restriction in C. elegans. Curr Biol, 17:1646-1656.
[27] Hsin H, Kenyon C (1999). Signals from the reproductive system regulate the lifespan of C. elegans. Nature, 399:362-366.
[28] Sun X, Chen WD, Wang YD (2017). DAF-16/FOXO Transcription Factor in Aging and Longevity. Front Pharmacol, 8:548.
[29] Murphy CT, McCarroll SA, Bargmann CI, Fraser A, Kamath RS, Ahringer J, et al. (2003). Genes that act downstream of DAF-16 to influence the lifespan of Caenorhabditis elegans. Nature, 424:277-283.
[30] Murphy CT (2006). The search for DAF-16/FOXO transcriptional targets: approaches and discoveries. Exp Gerontol, 41:910-921.
[31] Honda Y, Honda S (1999). The daf-2 gene network for longevity regulates oxidative stress resistance and Mn-superoxide dismutase gene expression in Caenorhabditis elegans. FASEB J, 13:1385-1393.
[32] Bluher M, Kahn BB, Kahn CR (2003). Extended longevity in mice lacking the insulin receptor in adipose tissue. Science, 299:572-574.
[33] Giannakou ME, Goss M, Junger MA, Hafen E, Leevers SJ, Partridge L (2004). Long-lived Drosophila with overexpressed dFOXO in adult fat body. Science, 305:361.
[34] Hwangbo DS, Gershman B, Tu MP, Palmer M, Tatar M (2004). Drosophila dFOXO controls lifespan and regulates insulin signalling in brain and fat body. Nature, 429:562-566.
[35] Perry B, Zhang J, Sun C, Saleh T, Wang Y (2012). Liuwei dihuang lowers body weight and improves insulin and leptin sensitivity in obese rats. Evid Based Complement Alternat Med.
[36] Nair SV, Zhang J, Wang Y (2014). Ethanol extract of Liuwei Dihuang reduces weight gain and visceral fat in obese-prone CD rats fed a high-fat diet. Exp Biol Med (Maywood), 239:552-558.
[37] Balch WE, Morimoto RI, Dillin A, Kelly JW (2008). Adapting proteostasis for disease intervention. Science, 319:916-919.
[38] Kurz CL, Tan MW (2004). Regulation of aging and innate immunity in C. elegans. Aging Cell, 3:185-193.
[39] Sarkis GJ, Ashcom JD, Hawdon JM, Jacobson LA (1988). Decline in protease activities with age in the nematode Caenorhabditis elegans. Mech Ageing Dev, 45:191-201.
[40] Kastle M, Grune T (2011). Protein oxidative modification in the aging organism and the role of the ubiquitin proteasomal system. Current Pharmaceutical Design, 17:4007-4022.
[41] Ghazi A, Henis-Korenblit S, Kenyon C (2007). Regulation of Caenorhabditis elegans lifespan by a proteasomal E3 ligase complex. Proc Natl Acad Sci U S A, 104:5947-5952.
[42] Vilchez D, Morantte I, Liu Z, Douglas PM, Merkwirth C, Rodrigues AP, et al. (2012). RPN-6 determines C. elegans longevity under proteotoxic stress conditions. Nature, 489:263-268.
[43] Mallo GV, Kurz CL, Couillault C, Pujol N, Granjeaud S, Kohara Y, et al. (2002). Inducible antibacterial defense system in C. elegans. Curr Biol, 12:1209-1214.
[44] Troemel ER, Chu SW, Reinke V, Lee SS, Ausubel FM, Kim DH (2006). p38 MAPK regulates expression of immune response genes and contributes to longevity in C. elegans. PLoS Genet, 2:e183.
[45] Yu YB, Dosanjh L, Lao L, Tan M, Shim BS, Luo Y (2010). Cinnamomum cassia bark in two herbal formulas increases life span in Caenorhabditis elegans via insulin signaling and stress response pathways. PLoS One, 5:e9339.
[46] Lau KM, Lai KK, Liu CL, Tam JC, To MH, Kwok HF, et al. (2012). Synergistic interaction between Astragali Radix and Rehmanniae Radix in a Chinese herbal formula to promote diabetic wound healing. Journal of Ethnopharmacology, 141:250.
[47] Poon TY, Ong KL, Cheung BM (2011). Review of the effects of the traditional Chinese medicine Rehmannia Six Formula on diabetes mellitus and its complications. J Diabetes, 3:184-200.
[1] Supplementary data Download
[1] Jin Kunlin. A Microcirculatory Theory of Aging[J]. Aging and disease, 2019, 10(3): 676-683.
[2] Qin Wei, Chen Shiya, Yang Shasha, Xu Qian, Xu Chuanshan, Cai Jing. The Effect of Traditional Chinese Medicine on Neural Stem Cell Proliferation and Differentiation[J]. Aging and disease, 2017, 8(6): 792-811.
[3] Moskalev Alexey, Chernyagina Elizaveta, Kudryavtseva Anna, Shaposhnikov Mikhail. Geroprotectors: A Unified Concept and Screening Approaches[J]. Aging and disease, 2017, 8(3): 354-363.
[4] Wang Jianhui, Cheng Xiaorui, Zeng Ju, Yuan Jiangbei, Wang Zhongfu, Zhou Wenxia, Zhang Yongxiang. LW-AFC Effects on N-glycan Profile in Senescence-Accelerated Mouse Prone 8 Strain, a Mouse Model of Alzheimer’s Disease[J]. Aging and disease, 2017, 8(1): 101-114.
[5] Myat Thu Thu Win,Yasuhiko Yamamoto,Seiichi Munesue,Dong Han,Shin-ichi Harada,Hiroshi Yamamoto. Validated Liquid Culture Monitoring System for Lifespan Extension of Caenorhabditis elegans through Genetic and Dietary Manipulations[J]. Aging and Disease, 2013, 4(4): 178-185.
[6] Raghavan Raju,Bixi Jian,William Hubbard,Irshad Chaudry. The Mitoscriptome in Aging and Disease[J]. Aging and Disease, 2011, 2(2): 174-180.
[7] Kunlin Jin. Modern Biological Theories of Aging[J]. Aging and Disease, 2010, 1(2): 72-74.
Viewed
Full text


Abstract

Cited

  Shared   
Copyright © 2014 Aging and Disease, All Rights Reserved.
Address: Aging and Disease Editorial Office 3400 Camp Bowie Boulevard Fort Worth, TX76106 USA
Fax: (817) 735-0408 E-mail: editorial@aginganddisease.org
Powered by Beijing Magtech Co. Ltd