Please wait a minute...
 Home  About the Journal Editorial Board Aims & Scope Peer Review Policy Subscription Contact us
 
Early Edition  //  Current Issue  //  Open Special Issues  //  Archives  //  Most Read  //  Most Downloaded  //  Most Cited
Aging and disease    2019, Vol. 10 Issue (3) : 611-625     DOI: 10.14336/AD.2018.0707
Orginal Article |
BDNF Alleviates Neuroinflammation in the Hippocampus of Type 1 Diabetic Mice via Blocking the Aberrant HMGB1/RAGE/NF-κB Pathway
Rongrong Han1,2, Zeyue Liu1,2, Nannan Sun1,2, Shu Liu1,2, Lanlan Li1,2, Yan Shen1,2, Jianbo Xiu1,2,*, Qi Xu1,2,*
1State Key Laboratory of Medical Molecular Biology, Institute of Basic Medical Sciences, Chinese Academy of Medical Sciences, School of Basic Medicine Peking Union Medical College, Beijing, China
2Neuroscience center, Chinese Academy of Medical Sciences, Beijing, China
Download: PDF(1758 KB)   HTML
Export: BibTeX | EndNote | Reference Manager | ProCite | RefWorks    
Abstract  

Diabetes is a systemic disease that can cause brain damage such as synaptic impairments in the hippocampus, which is partly because of neuroinflammation induced by hyperglycemia. Brain-derived neurotrophic factor (BDNF) is essential in modulating neuroplasticity. Its role in anti-inflammation in diabetes is largely unknown. In the present study, we investigated the effects of BDNF overexpression on reducing neuroinflammation and the underlying mechanism in mice with type 1 diabetes induced by streptozotocin (STZ). Animals were stereotactically microinjected in the hippocampus with recombinant adeno-associated virus (AAV) expressing BDNF or EGFP. After virus infection, four groups of mice, the EGFP+STZ, BDNF+STZ, EGFP Control and BDNF Control groups, received STZ or vehicle treatment as indicated. Three weeks later brain tissues were collected. We found that BDNF overexpression in the hippocampus significantly rescued STZ-induced decreases in mRNA and protein expression of two synaptic plasticity markers, spinophilin and synaptophysin. More interestingly, BDNF inhibited hyperglycemia-induced microglial activation and reduced elevated levels of inflammatory factors (TNF-α, IL-6). BDNF blocked the increase in HMGB1 levels and specifically, in levels of one of the HMGB1 receptors, RAGE. Downstream of HMGB1/RAGE, the increase in the protein level of phosphorylated NF-κB was also reversed by BDNF in STZ-treated mice. These results show that BDNF overexpression reduces neuroinflammation in the hippocampus of type 1 diabetic mice and suggest that the HMGB1/RAGE/NF-κB signaling pathway may contribute to alleviation of neuroinflammation by BDNF in diabetic mice.

Keywords diabetes      BDNF      neuroinflammation      HMGB1      RAGE     
Corresponding Authors: Xiu Jianbo,Xu Qi   
About author:

These authors contributed equally to this work.

Issue Date: 28 March 2018
Service
E-mail this article
E-mail Alert
RSS
Articles by authors
Rongrong Han
Zeyue Liu
Nannan Sun
Shu Liu
Lanlan Li
Yan Shen
Jianbo Xiu
Qi Xu
Cite this article:   
Rongrong Han,Zeyue Liu,Nannan Sun, et al. BDNF Alleviates Neuroinflammation in the Hippocampus of Type 1 Diabetic Mice via Blocking the Aberrant HMGB1/RAGE/NF-κB Pathway[J]. Aging and disease, 2019, 10(3): 611-625.
URL:  
http://www.aginganddisease.org/EN/10.14336/AD.2018.0707     OR     http://www.aginganddisease.org/EN/Y2019/V10/I3/611
Gene namesPrimer sequences
HMGB1Forward: 5′-TGCCTCGCGGAGGAAAATC-3′
Reverse: 5′-AACGAGCCTTGTCAGCCTTT-3′
RAGEForward: 5′-GAATAGTCGCTCCTGGTGGG-3′
Reverse: 5′-CAGCTATAGGTGCCCTCATCC-3′
TLR2Forward: 5′- GTGCGGACTGTTTCCTTCTG-3′
Reverse: 5′- GCGTTTGCTGAAGAGGACTG-3′
TLR4Forward: 5′-ATCCCTGCATAGAGGTAGTTCC-3′
Reverse: 5′-GGTGGTGTAAGCCATGCCA-3′
SynaptophysinForward: 5′- TCGTGTTCAAGGAGACAGGC -3′
Reverse: 5′- CTGCCCGTAATCGGGTTGAT -3′
SpinophilinForward: 5′- AGGGAGGGAGGTCAGCTTAG -3′
Reverse: 5′- AAACGTTGGAAAACAGCGGG -3′
GAPDHForward: 5′- CCTGCTTCACCACCTTCTTGA-3′
Reverse: 5′- TGTGTCCGTCGTGGATCTGA-3′
Table 1  Primers used in the study.
Figure 1.  BDNF gene transfer in the hippocampus

(A) Schematics of the AAV vector construction. (B) Schematics illustrating virus microinjection. (C) EGFP fluorescence demonstrating the site of virus expression. Scale bars represent 200 μm. (D) Western blot analysis of BDNF expression in the hippocampus after virus injection. (E) Western blot assay of p-TrkB. Values are means ± SEM. n = 6-7 per group. * p < 0.05, ** p < 0.01.

Figure 2.  STZ-induced type 1 diabetes in mice

(A) Schematic representation of the study design and treatment schedule. (B) Body weight after STZ treatment. (C) Blood glucose levels after STZ treatment. Values are means ± SEM. n = 10-12 per group. * p < 0.05, ** p < 0.01, indicating the comparison between the EGFP Control and EGFP+STZ groups.

Figure 3.  BDNF blocked the hyperglycemia-induced decrease in the expression of spinophilin and synaptophysin of diabetic mice

(A) Real time PCR analysis of spinophilin. (B) Real time PCR analysis of synaptophysin. (C) Western blot assay of spinophilin. (D) Western blot assay of synaptophysin. Values are means ± SEM. n = 6-7 per group. * p < 0.05, ** p < 0.01.

Figure 4.  BDNF overexpression suppressed microglial activation and reduced the increased levels of TNF-α and IL-6 in the hippocampus of diabetic mice

(A) Immunofluorescent staining and quantification of the microglial marker Iba-1. (B) ELISA assay of TNF-α. (C) ELISA assay of IL-6. (D) ELISA assay of IL-1β. Values are means ± SEM. n = 6-7 per group. * p < 0.05, ** p < 0.01. Scale bars = 20 μm.

Figure 5.  BDNF suppressed the increased expression of HMGB1 in the hippocampus of diabetic mice

(A) Real time PCR analysis of HMGB1. (B) Western blot assay of HMGB1. (C) Immunofluorescent staining and quantification of HMGB1. The values are expressed as mean ± SEM. n = 6-7 per group. * p < 0.05, ** p < 0.01. Scale bars = 200 μm.

Figure 6.  BDNF inhibited HMGB1-mediated activation of the RAGE/NF-κB signaling pathway in the hippocampus of diabetic mice

(A) Real time PCR analysis of the HMGB1 receptor TLR2. (B) Real time PCR analysis of the HMGB1 receptor TLR4. (C) Real time PCR analysis of the HMGB1 receptor RAGE. (D) Western blot assay of RAGE. (E) Western blot assay of NF-κB p65. (F) Western blot assay of p-NF-κB p65. The values are expressed as means ± SEM. n = 6-7 in each group. * p < 0.05, ** p < 0.01.

Figure 7.  Schematics illustrating the possible neuroprotective mechanisms of BDNF in the hyperglycemia-induced neuroinflammation

In the hippocampus of the diabetic brain, hyperglycemia leads to microglial activation and increased levels of inflammatory factors, ultimately resulting in synaptic impairments. BDNF can alleviate the hyperglycemia-induced neuroinflammation via specifically inhibiting the aberrant HMGB1/ RAGE/NF-κB signaling pathway.

[1] Borges NB, Ferraz MB, Chacra AR (2014). The cost of type 2 diabetes in Brazil: evaluation of a diabetes care center in the city of Sao Paulo, Brazil. Diabetol Metab Syndr, 6:122.
[2] Cukierman T, Gerstein HC, Williamson JD (2005). Cognitive decline and dementia in diabetes--systematic overview of prospective observational studies. Diabetologia, 48:2460-2469.
[3] Biessels GJ, Staekenborg S, Brunner E, Brayne C, Scheltens P (2006). Risk of dementia in diabetes mellitus: a systematic review. Lancet Neurol, 5:64-74.
[4] Stranahan AM, Arumugam TV, Cutler RG, Lee K, Egan JM, Mattson MP (2008). Diabetes impairs hippocampal function through glucocorticoid-mediated effects on new and mature neurons. Nat Neurosci, 11:309-317.
[5] Vinik A, Casellini C, Nevoret ML. 2000. Diabetic Neuropathies. In Endotext. De Groot L.J., Chrousos G., Dungan K., Feingold K.R., Grossman A., Hershman J.M., Koch C., Korbonits M., McLachlan R., New M., et al., editors. South Dartmouth (MA).
[6] Muriach M, Flores-Bellver M, Romero FJ, Barcia JM (2014). Diabetes and the brain: oxidative stress, inflammation, and autophagy. Oxid Med Cell Longev, 2014:102158.
[7] Chung WS, Welsh CA, Barres BA, Stevens B (2015). Do glia drive synaptic and cognitive impairment in disease? Nat Neurosci, 18:1539-1545.
[8] Poo MM (2001). Neurotrophins as synaptic modulators. Nat Rev Neurosci, 2:24-32.
[9] Egan MF, Kojima M, Callicott JH, Goldberg TE, Kolachana BS, Bertolino A, et al. (2003). The BDNF val66met polymorphism affects activity-dependent secretion of BDNF and human memory and hippocampal function. Cell, 112:257-269.
[10] Zhen YF, Zhang J, Liu XY, Fang H, Tian LB, Zhou DH, et al. (2013). Low BDNF is associated with cognitive deficits in patients with type 2 diabetes. Psychopharmacology (Berl), 227:93-100.
[11] Bathina S, Srinivas N, Das UN (2017). Streptozotocin produces oxidative stress, inflammation and decreases BDNF concentrations to induce apoptosis of RIN5F cells and type 2 diabetes mellitus in Wistar rats. Biochem Biophys Res Commun, 486:406-413.
[12] Xia X, Zhang Q, Liu R, Wang Z, Tang N, Liu F, et al. (2014). Effects of 20-hydroxyecdysone on improving memory deficits in streptozotocin-induced type 1 diabetes mellitus in rat. Eur J Pharmacol, 740:45-52.
[13] Bianchi ME, Manfredi AA (2007). High-mobility group box 1 (HMGB1) protein at the crossroads between innate and adaptive immunity. Immunol Rev, 220:35-46.
[14] Bianchi ME, Crippa MP, Manfredi AA, Mezzapelle R, Rovere Querini P, Venereau E (2017). High-mobility group box 1 protein orchestrates responses to tissue damage via inflammation, innate and adaptive immunity, and tissue repair. Immunol Rev, 280:74-82.
[15] Lotze MT, Tracey KJ (2005). High-mobility group box 1 protein (HMGB1): nuclear weapon in the immune arsenal. Nat Rev Immunol, 5:331-342.
[16] Wang Y, Zhong J, Zhang X, Liu Z, Yang Y, Gong Q, et al. (2016). The Role of HMGB1 in the Pathogenesis of Type 2 Diabetes. J Diabetes Res, 2016:2543268.
[17] Zhang S, Zhong J, Yang P, Gong F, Wang CY (2009). HMGB1, an innate alarmin, in the pathogenesis of type 1 diabetes. Int J Clin Exp Pathol, 3:24-38.
[18] Wang X, Feng C, Qiao Y, Zhao X (2018). Sigma 1 receptor mediated HMGB1 expression in spinal cord is involved in the development of diabetic neuropathic pain. Neurosci Lett, 668:164-168.
[19] Nogueira-Machado JA, de Oliveira Volpe CM (2012). HMGB-1 as a target for inflammation controlling. Recent Pat Endocr Metab Immune Drug Discov, 6:201-209.
[20] Norden DM, Trojanowski PJ, Villanueva E, Navarro E, Godbout JP (2016). Sequential activation of microglia and astrocyte cytokine expression precedes increased Iba-1 or GFAP immunoreactivity following systemic immune challenge. Glia, 64:300-316.
[21] Chao MV (2003). Neurotrophins and their receptors: a convergence point for many signalling pathways. Nat Rev Neurosci, 4:299-309.
[22] Biessels GJ, Cristino NA, Rutten GJ, Hamers FP, Erkelens DW, Gispen WH (1999). Neurophysiological changes in the central and peripheral nervous system of streptozotocin-diabetic rats. Course of development and effects of insulin treatment. Brain, 122 (Pt 4):757-768.
[23] Lu B, Nagappan G, Guan X, Nathan PJ, Wren P (2013). BDNF-based synaptic repair as a disease-modifying strategy for neurodegenerative diseases. Nat Rev Neurosci, 14:401-416.
[24] Allen PB, Ouimet CC, Greengard P (1997). Spinophilin, a novel protein phosphatase 1 binding protein localized to dendritic spines. Proc Natl Acad Sci U S A, 94:9956-9961.
[25] Thiel G (1993). Synapsin I, synapsin II, and synaptophysin: marker proteins of synaptic vesicles. Brain Pathol, 3:87-95.
[26] Di Sebastiano AR, Fahim S, Dunn HA, Walther C, Ribeiro FM, Cregan SP, et al. (2016). Role of Spinophilin in Group I Metabotropic Glutamate Receptor Endocytosis, Signaling, and Synaptic Plasticity. J Biol Chem, 291:17602-17615.
[27] Kwon SE, Chapman ER (2011). Synaptophysin regulates the kinetics of synaptic vesicle endocytosis in central neurons. Neuron, 70:847-854.
[28] Aguzzi A, Barres BA, Bennett ML (2013). Microglia: scapegoat, saboteur, or something else? Science, 339:156-161.
[29] Stephan AH, Barres BA, Stevens B (2012). The complement system: an unexpected role in synaptic pruning during development and disease. Annu Rev Neurosci, 35:369-389.
[30] Paolicelli RC, Bolasco G, Pagani F, Maggi L, Scianni M, Panzanelli P, et al. (2011). Synaptic pruning by microglia is necessary for normal brain development. Science, 333:1456-1458.
[31] Takizawa T, Shibata M, Kayama Y, Shimizu T, Toriumi H, Ebine T, et al. (2017). High-mobility group box 1 is an important mediator of microglial activation induced by cortical spreading depression. J Cereb Blood Flow Metab, 37:890-901.
[32] Masson GS, Nair AR, Silva Soares PP, Michelini LC, Francis J (2015). Aerobic training normalizes autonomic dysfunction, HMGB1 content, microglia activation and inflammation in hypothalamic paraventricular nucleus of SHR. Am J Physiol Heart Circ Physiol, 309:H1115-1122.
[33] Bierhaus A, Haslbeck KM, Humpert PM, Liliensiek B, Dehmer T, Morcos M, et al. (2004). Loss of pain perception in diabetes is dependent on a receptor of the immunoglobulin superfamily. J Clin Invest, 114:1741-1751.
[34] Paolino AS, Garner KM (2005). Effects of hyperglycemia on neurologic outcome in stroke patients. J Neurosci Nurs, 37:130-135.
[35] Kim DW, Moon Y, Gee Noh H, Choi JW, Oh J (2011). Blood-brain barrier disruption is involved in seizure and hemianopsia in nonketotic hyperglycemia. Neurologist, 17:164-166.
[36] Biessels GJ, Kamal A, Ramakers GM, Urban IJ, Spruijt BM, Erkelens DW, et al. (1996). Place learning and hippocampal synaptic plasticity in streptozotocin-induced diabetic rats. Diabetes, 45:1259-1266.
[37] Lu Y, Christian K, Lu B (2008). BDNF: a key regulator for protein synthesis-dependent LTP and long-term memory? Neurobiol Learn Mem, 89:312-323.
[38] Diogenes MJ, Costenla AR, Lopes LV, Jeronimo-Santos A, Sousa VC, Fontinha BM, et al. (2011). Enhancement of LTP in aged rats is dependent on endogenous BDNF. Neuropsychopharmacology, 36:1823-1836.
[39] Krabbe KS, Nielsen AR, Krogh-Madsen R, Plomgaard P, Rasmussen P, Erikstrup C, et al. (2007). Brain-derived neurotrophic factor (BDNF) and type 2 diabetes. Diabetologia, 50:431-438.
[40] Nitta A, Murai R, Suzuki N, Ito H, Nomoto H, Katoh G, et al. (2002). Diabetic neuropathies in brain are induced by deficiency of BDNF. Neurotoxicol Teratol, 24:695-701.
[41] Zhao Q, Matsumoto K, Tsuneyama K, Tanaka K, Li F, Shibahara N, et al. (2011). Diabetes-induced central cholinergic neuronal loss and cognitive deficit are attenuated by tacrine and a Chinese herbal prescription, kangen-karyu: elucidation in type 2 diabetes db/db mice. J Pharmacol Sci, 117:230-242.
[42] Meek TH, Wisse BE, Thaler JP, Guyenet SJ, Matsen ME, Fischer JD, et al. (2013). BDNF action in the brain attenuates diabetic hyperglycemia via insulin-independent inhibition of hepatic glucose production. Diabetes, 62:1512-1518.
[43] Cao L, Lin EJ, Cahill MC, Wang C, Liu X, During MJ (2009). Molecular therapy of obesity and diabetes by a physiological autoregulatory approach. Nat Med, 15:447-454.
[44] Bogush M, Heldt NA, Persidsky Y (2017). Blood Brain Barrier Injury in Diabetes: Unrecognized Effects on Brain and Cognition. J Neuroimmune Pharmacol, 12:593-601.
[45] Hamed SA (2017). Brain injury with diabetes mellitus: evidence, mechanisms and treatment implications. Expert Rev Clin Pharmacol, 10:409-428.
[46] Hughes V (2012). Microglia: The constant gardeners. Nature, 485:570-572.
[47] Parkhurst CN, Yang G, Ninan I, Savas JN, Yates JR 3rd, Lafaille JJ, et al. (2013). Microglia promote learning-dependent synapse formation through brain-derived neurotrophic factor. Cell, 155:1596-1609.
[48] Ransohoff RM (2016). How neuroinflammation contributes to neurodegeneration. Science, 353:777-783.
[49] Kreutzberg GW (1996). Microglia: a sensor for pathological events in the CNS. Trends Neurosci, 19:312-318.
[50] DiSabato DJ, Quan N, Godbout JP (2016). Neuroinflammation: the devil is in the details. J Neurochem, 139 Suppl 2:136-153.
[51] De Santi L, Polimeni G, Cuzzocrea S, Esposito E, Sessa E, Annunziata P, et al. (2011). Neuroinflammation and neuroprotection: an update on (future) neurotrophin-related strategies in multiple sclerosis treatment. Curr Med Chem, 18:1775-1784.
[52] Wu SY, Wang TF, Yu L, Jen CJ, Chuang JI, Wu FS, et al. (2011). Running exercise protects the substantia nigra dopaminergic neurons against inflammation-induced degeneration via the activation of BDNF signaling pathway. Brain Behav Immun, 25:135-146.
[53] Li C, Li M, Yu H, Shen X, Wang J, Sun X, et al. (2017). Neuropeptide VGF C-Terminal Peptide TLQP-62 Alleviates Lipopolysaccharide-Induced Memory Deficits and Anxiety-like and Depression-like Behaviors in Mice: The Role of BDNF/TrkB Signaling. ACS Chem Neurosci, 8:2005-2018.
[54] Khallaf WAI, Messiha BAS, Abo-Youssef AMH, El-Sayed NS (2017). Protective effects of telmisartan and tempol on lipopolysaccharide-induced cognitive impairment, neuroinflammation, and amyloidogenesis: possible role of brain-derived neurotrophic factor. Can J Physiol Pharmacol, 95:850-860.
[55] Song X, Zhou B, Zhang P, Lei D, Wang Y, Yao G, et al. (2016). Protective Effect of Silibinin on Learning and Memory Impairment in LPS-Treated Rats via ROS-BDNF-TrkB Pathway. Neurochem Res, 41:1662-1672.
[56] Ren Z, Yan P, Zhu L, Yang H, Zhao Y, Kirby BP, et al. (2018). Dihydromyricetin exerts a rapid antidepressant-like effect in association with enhancement of BDNF expression and inhibition of neuroinflammation. Psychopharmacology (Berl), 235:233-244.
[57] Li DD, Xie H, Du YF, Long Y, Reed MN, Hu M, et al. (2018). Antidepressant-like effect of zileuton is accompanied by hippocampal neuroinflammation reduction and CREB/BDNF upregulation in lipopolysaccharide-challenged mice. J Affect Disord, 227:672-680.
[58] Park SE, Dantzer R, Kelley KW, McCusker RH (2011). Central administration of insulin-like growth factor-I decreases depressive-like behavior and brain cytokine expression in mice. J Neuroinflammation, 8:12.
[59] Bovolenta R, Zucchini S, Paradiso B, Rodi D, Merigo F, Navarro Mora G, et al. (2010). Hippocampal FGF-2 and BDNF overexpression attenuates epileptogenesis-associated neuroinflammation and reduces spontaneous recurrent seizures. J Neuroinflammation, 7:81.
[60] Xu D, Lian D, Wu J, Liu Y, Zhu M, Sun J, et al. (2017). Brain-derived neurotrophic factor reduces inflammation and hippocampal apoptosis in experimental Streptococcus pneumoniae meningitis. J Neuroinflammation, 14:156.
[61] Lai SW, Chen JH, Lin HY, Liu YS, Tsai CF, Chang PC, et al. (2018). Regulatory Effects of Neuroinflammatory Responses Through Brain-Derived Neurotrophic Factor Signaling in Microglial Cells. Mol Neurobiol.
[62] Devaraj S, Dasu MR, Park SH, Jialal I (2009). Increased levels of ligands of Toll-like receptors 2 and 4 in type 1 diabetes. Diabetologia, 52:1665-1668.
[63] Dasu MR, Devaraj S, Park S, Jialal I (2010). Increased toll-like receptor (TLR) activation and TLR ligands in recently diagnosed type 2 diabetic subjects. Diabetes Care, 33:861-868.
[64] Pachydaki SI, Tari SR, Lee SE, Ma W, Tseng JJ, Sosunov AA, et al. (2006). Upregulation of RAGE and its ligands in proliferative retinal disease. Exp Eye Res, 82:807-815.
[65] Kim J, Sohn E, Kim CS, Jo K, Kim JS (2011). The role of high-mobility group box-1 protein in the development of diabetic nephropathy. Am J Nephrol, 33:524-529.
[66] Wang WK, Lu QH, Wang X, Wang B, Wang J, Gong HP, et al. (2017). Ulinastatin attenuates diabetes-induced cardiac dysfunction by the inhibition of inflammation and apoptosis. Exp Ther Med, 14:2497-2504.
[67] Grigorov I, Bogojevic D, Jovanovic S, Petrovic A, Ivanovic-Matic S, Zolotarevski L, et al. (2014). Hepatoprotective effects of melatonin against pronecrotic cellular events in streptozotocin-induced diabetic rats. J Physiol Biochem, 70:441-450.
[68] Abu El-Asrar AM, Siddiquei MM, Nawaz MI, Geboes K, Mohammad G (2014). The proinflammatory cytokine high-mobility group box-1 mediates retinal neuropathy induced by diabetes. Mediators Inflamm, 2014:746415.
[69] Wang WK, Wang B, Lu QH, Zhang W, Qin WD, Liu XJ, et al. (2014). Inhibition of high-mobility group box 1 improves myocardial fibrosis and dysfunction in diabetic cardiomyopathy. Int J Cardiol, 172:202-212.
[70] Wang WK, Lu QH, Zhang JN, Wang B, Liu XJ, An FS, et al. (2014). HMGB1 mediates hyperglycaemia-induced cardiomyocyte apoptosis via ERK/Ets-1 signalling pathway. J Cell Mol Med, 18:2311-2320.
[71] Han J, Zhong J, Wei W, Wang Y, Huang Y, Yang P, et al. (2008). Extracellular high-mobility group box 1 acts as an innate immune mediator to enhance autoimmune progression and diabetes onset in NOD mice. Diabetes, 57:2118-2127.
[72] Hori O, Brett J, Slattery T, Cao R, Zhang J, Chen JX, et al. (1995). The receptor for advanced glycation end products (RAGE) is a cellular binding site for amphoterin. Mediation of neurite outgrowth and co-expression of rage and amphoterin in the developing nervous system. J Biol Chem, 270:25752-25761.
[73] Yu SL, Wong CK, Tam LS (2013). The alarmin functions of high-mobility group box-1 and IL-33 in the pathogenesis of systemic lupus erythematosus. Expert Rev Clin Immunol, 9:739-749.
[74] Sims GP, Rowe DC, Rietdijk ST, Herbst R, Coyle AJ (2010). HMGB1 and RAGE in inflammation and cancer. Annu Rev Immunol, 28:367-388.
[75] Ramasamy R, Yan SF, Schmidt AM (2011). Receptor for AGE (RAGE): signaling mechanisms in the pathogenesis of diabetes and its complications. Ann N Y Acad Sci, 1243:88-102.
[76] Zhang T, Hu X, Cai Y, Yi B, Wen Z (2014). Metformin protects against hyperglycemia-induced cardiomyocytes injury by inhibiting the expressions of receptor for advanced glycation end products and high mobility group box 1 protein. Mol Biol Rep, 41:1335-1340.
[77] Huttunen HJ, Fages C, Rauvala H (1999). Receptor for advanced glycation end products (RAGE)-mediated neurite outgrowth and activation of NF-kappaB require the cytoplasmic domain of the receptor but different downstream signaling pathways. J Biol Chem, 274:19919-19924.
[78] Penzo M, Molteni R, Suda T, Samaniego S, Raucci A, Habiel DM, et al. (2010). Inhibitor of NF-kappa B kinases alpha and beta are both essential for high mobility group box 1-mediated chemotaxis [corrected]. J Immunol, 184:4497-4509.
[79] Bangert A, Andrassy M, Muller AM, Bockstahler M, Fischer A, Volz CH, et al. (2016). Critical role of RAGE and HMGB1 in inflammatory heart disease. Proc Natl Acad Sci U S A, 113:E155-164.
[80] Hudson BI, Lippman ME (2018). Targeting RAGE Signaling in Inflammatory Disease. Annu Rev Med, 69:349-364.
[1] Han Fei, Li Xiaochen, Yang Juhong, Liu Haiyi, Zhang Yi, Yang Xiaoyun, Yang Shaohua, Chang Bai, Chen Liming, Chang Baocheng. Salsalate Prevents β-Cell Dedifferentiation in OLETF Rats with Type 2 Diabetes through Notch1 Pathway[J]. Aging and disease, 2019, 10(4): 719-730.
[2] Dubey Navneet Kumar, Wei Hong-Jian, Yu Sung-Hsun, Williams David F., Wang Joseph R., Deng Yue-Hua, Tsai Feng-Chou, Wang Peter D., Deng Win-Ping. Adipose-derived Stem Cells Attenuates Diabetic Osteoarthritis via Inhibition of Glycation-mediated Inflammatory Cascade[J]. Aging and disease, 2019, 10(3): 483-496.
[3] Li Kunyu, Li Jiatong, Zheng Jialin, Qin Song. Reactive Astrocytes in Neurodegenerative Diseases[J]. Aging and disease, 2019, 10(3): 664-675.
[4] Sarkar Saumyendra N., Russell Ashley E., Engler-Chiurazzi Elizabeth B., Porter Keyana N., Simpkins James W.. MicroRNAs and the Genetic Nexus of Brain Aging, Neuroinflammation, Neurodegeneration, and Brain Trauma[J]. Aging and disease, 2019, 10(2): 329-352.
[5] Li Feng-Juan, Zhang Cheng-Long, Luo Xiu-Ju, Peng Jun, Yang Tian-Lun. Involvement of the MiR-181b-5p/HMGB1 Pathway in Ang II-induced Phenotypic Transformation of Smooth Muscle Cells in Hypertension[J]. Aging and disease, 2019, 10(2): 231-248.
[6] Tseng Chin-Hsiao. Metformin and the Risk of Dementia in Type 2 Diabetes Patients[J]. Aging and disease, 2019, 10(1): 37-48.
[7] Antonina Luca, Carmela Calandra, Maria Luca. Molecular Bases of Alzheimer’s Disease and Neurodegeneration: The Role of Neuroglia[J]. Aging and disease, 2018, 9(6): 1134-1152.
[8] Changhong Ren, Hang Wu, Dongjie Li, Yong Yang, Yuan Gao, Yunneng Jizhang, Dachuan Liu, Xunming Ji, Xuxiang Zhang. Remote Ischemic Conditioning Protects Diabetic Retinopathy in Streptozotocin-induced Diabetic Rats via Anti-Inflammation and Antioxidation[J]. Aging and disease, 2018, 9(6): 1122-1133.
[9] Yong-Fei Zhao, Qiong Zhang, Jian-Feng Zhang, Zhi-Yin Lou, Hen-Bing Zu, Zi-Gao Wang, Wei-Cheng Zeng, Kai Yao, Bao-Guo Xiao. The Synergy of Aging and LPS Exposure in a Mouse Model of Parkinson’s Disease[J]. Aging and disease, 2018, 9(5): 785-797.
[10] Maxime Fournet, Frederic Bonte, Alexis Desmouliere. Glycation Damage: A Possible Hub for Major Pathophysiological Disorders and Aging[J]. Aging and disease, 2018, 9(5): 880-900.
[11] Yang Yao-Chih, Tsai Cheng-Yen, Chen Chien-Lin, Kuo Chia-Hua, Hou Chien-Wen, Cheng Shi-Yann, Aneja Ritu, Huang Chih-Yang, Kuo Wei-Wen. Pkcδ Activation is Involved in ROS-Mediated Mitochondrial Dysfunction and Apoptosis in Cardiomyocytes Exposed to Advanced Glycation End Products (Ages)[J]. Aging and disease, 2018, 9(4): 647-663.
[12] Li Wenjun, Roy Choudhury Gourav, Winters Ali, Prah Jude, Lin Wenping, Liu Ran, Yang Shao-Hua. Hyperglycemia Alters Astrocyte Metabolism and Inhibits Astrocyte Proliferation[J]. Aging and disease, 2018, 9(4): 674-684.
[13] Chen Yali, Yin Mengmei, Cao Xuejin, Hu Gang, Xiao Ming. Pro- and Anti-inflammatory Effects of High Cholesterol Diet on Aged Brain[J]. Aging and disease, 2018, 9(3): 374-390.
[14] Yan Tao, Venkat Poornima, Chopp Michael, Zacharek Alex, Yu Peng, Ning Ruizhuo, Qiao Xiaoxi, Kelley Mark R., Chen Jieli. APX3330 Promotes Neurorestorative Effects after Stroke in Type One Diabetic Rats[J]. Aging and disease, 2018, 9(3): 453-466.
[15] Shen Ting, You Yuyi, Joseph Chitra, Mirzaei Mehdi, Klistorner Alexander, Graham Stuart L., Gupta Vivek. BDNF Polymorphism: A Review of Its Diagnostic and Clinical Relevance in Neurodegenerative Disorders[J]. Aging and disease, 2018, 9(3): 523-536.
Viewed
Full text


Abstract

Cited

  Shared   
Copyright © 2014 Aging and Disease, All Rights Reserved.
Address: Aging and Disease Editorial Office 3400 Camp Bowie Boulevard Fort Worth, TX76106 USA
Fax: (817) 735-0408 E-mail: editorial@aginganddisease.org
Powered by Beijing Magtech Co. Ltd