Please wait a minute...
 Home  About the Journal Editorial Board Aims & Scope Peer Review Policy Subscription Contact us
 
Early Edition  //  Current Issue  //  Open Special Issues  //  Archives  //  Most Read  //  Most Downloaded  //  Most Cited
Aging and disease    2019, Vol. 10 Issue (4) : 699-710     DOI: 10.14336/AD.2018.1128
Orginal Article |
IgE Aggravates the Senescence of Smooth Muscle Cells in Abdominal Aortic Aneurysm by Upregulating LincRNA-p21
Wenjun Guo, Ran Gao, Wei Zhang, Weipeng Ge, Meng Ren, Bolun Li, Hongmei Zhao, Jing Wang*
State Key Laboratory of Medical Molecular Biology, Institute of Basic Medical Sciences, Chinese Academy of Medical Sciences, Department of Pathophysiology, Peking Union Medical College, Beijing, China
Download: PDF(1269 KB)   HTML
Export: BibTeX | EndNote | Reference Manager | ProCite | RefWorks    
Abstract  

Immunoglobulin E (lgE) activates immunity by binding to mast cells and basophils. It is well-known that IgE and its receptor, FcɛR1, play a key role in the development of airway inflammation and remodeling in allergic asthma. Recent studies show that IgE also plays an important role in abdominal aortic aneurysm (AAA) pathogenesis. However, the mechanism by which IgE promotes AAA remains unclear. Here we report that in our mouse model, asthma-induced high level of IgE aggravated AAA, but IgE lost this effect on AAA in FcɛR1-/- mice. Our in vitro study revealed that IgE induced smooth muscle cell senescence via upregulating lincRNA-p21 against p21 without altering expression of p53. By this mechanism, IgE accelerated AAA in ApoE-/- mice, which was blocked by knockdown of lincRNA-p21 in both vitro and vivo. This study suggests that IgE actives the lincRNAp21-p21 pathway to induce SMC senescence, which contributes to the formation of AAA, and lincRNA-p21 is a potential therapeutic target for AAA aggravated by asthma.

Keywords Asthma      IgE      Abdominal aortic aneurysms      Senescence      lincRNA-p21      p21     
Corresponding Authors: Wang Jing   
About author:

Wenjun Guo, Ran Gao and Wei Zhang contributed equally to this work.

Just Accepted Date: 06 December 2018   Issue Date: 01 August 2019
Service
E-mail this article
E-mail Alert
RSS
Articles by authors
Wenjun Guo
Ran Gao
Wei Zhang
Weipeng Ge
Meng Ren
Bolun Li
Hongmei Zhao
Jing Wang
Cite this article:   
Wenjun Guo,Ran Gao,Wei Zhang, et al. IgE Aggravates the Senescence of Smooth Muscle Cells in Abdominal Aortic Aneurysm by Upregulating LincRNA-p21[J]. Aging and disease, 2019, 10(4): 699-710.
URL:  
http://www.aginganddisease.org/EN/10.14336/AD.2018.1128     OR     http://www.aginganddisease.org/EN/Y2019/V10/I4/699
Gene NamePrimer Sequence (5’-3’)GenBank code
hlincRNA-p21 forwardGCTGCTGAAGTAGGAGCTTTKU881768.1
hlincRNA-p21 reverseGGATTCTGCTGATTCCAGTG
Human p21 forwardCATGTGGACCTGTCACTGTCTTNM_001291549
Human p21 reverseGCTTCCTCTTGGAGAAGATCAGC
Human p53 forwardTCATCACACTGGAAGACTCCAGNM_001126118
Human p53 reverseGCTGGTGTTGTTGGGCAGT
Human GAPDH forwardTCAACGACCACTTTGTCAAGCTCANM_001289745
Human GAPDH reverseGCTGGTGGTCCAGGGGTCTTACT
mlincRNA-p21 forwardCCACTCGCTTTCCATTTCCCNR_036469
mlincRNA-p21 reverseAACTGGAGACGGAATGTCTCAT
Mouse p21 forwardTCGCTGTCTTGCACTCTGGTGTNM_007669
Mouse p21 reverseCCAATCTGCGCTTGGAGTGATAG
Mouse p53 forwardGCGTAAACGCTTCGAGATGTTNM_011640
Mouse p53 reverseTTTTTATGGCGGGAAGTAGACTG
Mouse GAPDH forwardAGGTCGGTGTGAACGGATTTGNM_001289726
Mouse GAPDH reverseTGTAGACCATGTAGTTGAGGTCA
Table 1  Primer Sequences.
Figure 1.  Effect of IgE receptor, FcɛR1, on asthma-accelerated AAA

(A) Schematic diagram for the mouse model of asthma-accelerated AAA. (B) Representative pictures from Giemsa staining for bronchial-alveolar lavage fluid (BALF) cell, and Masson staining and H&E staining for lung tissue. Eosinophils Scale bars: 100μm. Collagen Scale bars: 50μm. Inflammation cells Scale bars: 50μm; (C) Anti-OVA IgE levels in serum; (D) Total number of cells in BALF; (E) Percentage of eosinophils in BALF; (F) Percentage of lymphocytes in BALF. (G) Images of mouse aorta of ApoE-/-mice treated with or without OVA, and ApoE-/-FcɛR1-/- mice treated with OVA. (H) The average diameters of the AAA. (I) The incidence rate of AAA in ApoE-/-, OVA-treated ApoE-/-, and OVA-treated ApoE-/-FcɛR1-/- mice. (J) Representative staining for elastin at AAA lesions where the most severe elastin degradation occurred. Scale bars: 100μm. (K) Scores from the elastin degradation classification for AAA lesions of the mice with the indicated genotype. Data information: In (C-F, H, I, K), data are presented as mean ± SEM (n=15 per group). *P < 0.05; **P<0.01

Figure 2.  Inflammation and remodeling in AAA lesion

(A-G) AAA lesion macrophage content (A); CD4+ T-cell content (B); major histocompatibility complex (MHC) class-II-positive area (C); mast cell content (D); and chemokine TNF-α-positive area (E); IL-6-positive area (F); and MCP-1-positive area (G) from ApoE-/-mice treated with or without OVA, and from OVA-treated ApoE-/-FcɛR1-/- mice. (H-J) The expression of plasma inflammatory factors, TNF-α (H), IL-6 (I), and IFN-γ (J) in serum from PBS ApoE-/-, OVA ApoE-/- and OVA ApoE-/-FcɛR1-/- mice; (K) Statistic analysis of TUNEL staining for apoptotic cells in the AAA tissue from ApoE-/-mice treated with or without OVA, and from OVA-treated ApoE-/-FcɛR1-/- mice. (L) Cell content of apoptotic vascular smooth muscle cell in AAA lesion from PBS ApoE-/-, OVA ApoE-/- and OVA ApoE-/-FcɛR1-/- mice. (M) Representative picture of β-galactosidase staining for senescent cells in AAA lesions. Scale bars: 25μm. (N) Counts for senescent cells/mm2 in the AAA lesions. Data information: Data are presented as mean ± SEM (n=15 per group). *P < 0.05; **P<0.01.

Figure 3.  IgE effect on senescence of vascular SMCs in vitro and in vivo

(A) RT-PCR detection of FceR1α expression at different doses of IgE stimulation. (B) RT-PCR detection of FceR1α expression at different times of IgE stimulation. (C) Representative images from β-galactosidase staining of human vascular smooth under the indicated conditions. Scale bars: 100 μm. (D) The statistics of the results from C. (E) RT-PCR detection of p21 and p53 mRNA expression in IgE-stimulated HSMCs. (F) Western blotting analysis of p21 and p53 expression in human vascular smooth muscle cells stimulated by IgE. (G) Statistical analysis on the relative intensities of p21 and p53 bands in the Western blotting of human vascular smooth muscle cells stimulated by IgE. (H) The expression of p21 and p53 mRNA in human vascular smooth muscle cells stimulated by IgE. (I) RT-PCR detection of p21 and p53 mRNA expression in human vascular smooth muscle cells stimulated by IgE (J) Representative pictures of p21 immunohistochemical staining in AAA lesions. Scale bars: 25μm. (K) The statistical analysis of p21 immunohistochemical staining in AAA lesions. Data information: Data are presented as mean ± SEM (animal tissues; n=15 per group). *P < 0.05; **P<0.01

Figure 4.  The effect of lincRNA-p21 on senescence of human vascular SMCs

(A) The expression of lincRNA-p21 in human vascular smooth muscle cells stimulated by different doses of IgE. (B) The expression of lincRNA-p21 in human vascular smooth muscle cells stimulated by 10 μg/ml IgE at different time. (C) Detection of lincRNA-p21 expression in HSMC after transfectioned with lincRNA-p21 siRNA. (D) Representative images of HSMC β-galactosidase staining of control, IgE, si-lincRNAp21 and si-lincRNA-p21+IgE treatment groups. Scale bar: 100μm. (E) The senescent cell counts of HSMC after control, IgE, si-lincRNA-p21 or si-lincRNA-p21+IgE treatment. (F) PCR detection of p21 and p53 expression in HSMCs treated with IgE and si-lincRNA-p21. (G) Statistical analysis of p21 and p53 in HSMC treated with IgE and si-lincRNA-p21. (H) Western blot analysis of p21 and p53 in HSMC after IgE and si-lincRNA-p21 treatments. (I) Statistical analysis on the relative intensities of p21 and p53 protein expression in HSMC treated with IgE and si-lincRNA-p21. Data information: Data are presented as mean ± SEM. *P < 0.05; **P<0.01.

Figure 5.  The effect of lincRNA-p21 on formation of AAA

(A) Schematic diagram of animal model procedures. (B) Expression of lincRNA-p21 in AAA lesion of mice in control (n=8) and si-mlincRNA-p21 (n=5) groups. (C) Representative images of aortas from mice in control and si-mlincRNA-p21 groups of mice. (D) The average diameters of abdominal aortic aneurysm of two groups of mice. (E) The incidence rate of AAA in two groups of mice. (F) Representative pictures of β-galactosidase staining in AAA lesion. Scale bars: 25μm. (G) Senescent cells number per mm2 in AAA lesions. (H) Representative pictures of immunohistochemical staining for p21 in AAA lesions. Scale bars: 25μm. (I) The statistical analysis of p21 positive areas in immunohistochemical staining in AAA lesions. (J) RT-PCR detection of p21 and p53 mRNA expression in AAA lesions. (K) Schematic diagram of this article: IgE aggravates AAA mainly by upregulating lincRNA-p21 contributing to HSMC senescence. Data information: Data are presented as mean ± SEM. *P < 0.05; **P<0.01.

[1] Mozaffarian D, Benjamin EJ, Go AS, Arnett DK, Blaha MJ, Cushman M, et al. (2016). Heart Disease and Stroke Statistics-2016 Update: A Report From the American Heart Association. Circulation, 133: e38-360.
[2] Nishihara M, Aoki H, Ohno S, Furusho A, Hirakata S, Nishida N, et al. (2017). The role of IL-6 in pathogenesis of abdominal aortic aneurysm in mice. PLoS One, 12: e0185923.
[3] Chen HZ, Wang F, Gao P, Pei JF, Liu Y, Xu TT, et al. (2016). Age-Associated Sirtuin 1 Reduction in Vascular Smooth Muscle Links Vascular Senescence and Inflammation to Abdominal Aortic Aneurysm. Circ Res, 119: 1076-1088.
[4] Niu H, Li Y, Li H, Chi Y, Zhuang M, Zhang T, et al. (2016). Matrix metalloproteinase 12 modulates high-fat-diet induced glomerular fibrogenesis and inflammation in a mouse model of obesity. Sci Rep, 6: 20171.
[5] Clark D, Shiota F, Forte C, Narayanan P, Mytych DT, Hock MB (2013). Biomarkers for non-human primate type-I hypersensitivity: antigen-specific immunoglobulin E assays. J Immunol Methods, 392: 29-37.
[6] Davila I, Valero A, Entrenas LM, Valveny N, Herraez L, Grp SS (2015). Relationship Between Serum Total IgE and Disease Severity in Patients With Allergic Asthma in Spain. Journal of Investigational Allergology and Clinical Immunology, 25: 120-127.
[7] Lin JT (2016). [Long-term effectiveness and safety of anti-IgE treatment in allergic asthma]. Zhonghua Jie He He Hu Xi Za Zhi, 39: 733-736.
[8] Hong GU, Kim NG, Kim TJ, Ro JY (2014). CD1d expressed in mast cell surface enhances IgE production in B cells by up-regulating CD40L expression and mediator release in allergic asthma in mice. Cell Signal, 26: 1105-1117.
[9] Wierzbicki AT (2012). The role of long non-coding RNA in transcriptional gene silencing. Curr Opin Plant Biol, 15: 517-522.
[10] Young RS, Ponting CP (2013). Identification and function of long non-coding RNAs. Essays Biochem, 54: 113-126.
[11] Wu R, Su Y, Wu H, Dai Y, Zhao M, Lu Q (2016). Characters, functions and clinical perspectives of long non-coding RNAs. Mol Genet Genomics, 291: 1013-1033.
[12] Klattenhoff CA, Scheuermann JC, Surface LE, Bradley RK, Fields PA, Steinhauser ML, et al. (2013). Braveheart, a long noncoding RNA required for cardiovascular lineage commitment. Cell, 152: 570-583.
[13] Burd CE, Jeck WR, Liu Y, Sanoff HK, Wang Z, Sharpless NE (2010). Expression of linear and novel circular forms of an INK4/ARF-associated non-coding RNA correlates with atherosclerosis risk. PLoS Genet, 6: e1001233.
[14] Xie Z, Xia W, Hou M (2018). Long intergenic noncoding RNAp21 mediates cardiac senescence via the Wnt/betacatenin signaling pathway in doxorubicin-induced cardiotoxicity. Mol Med Rep, 17: 2695-2704.
[15] Wu G, Cai J, Han Y, Chen J, Huang ZP, Chen C, et al. (2014). LincRNA-p21 regulates neointima formation, vascular smooth muscle cell proliferation, apoptosis, and atherosclerosis by enhancing p53 activity. Circulation, 130: 1452-1465.
[16] Liu CL, Wang Y, Liao M, Wemmelund H, Ren J, Fernandes C, et al. (2016). Allergic Lung Inflammation Aggravates Angiotensin II-Induced Abdominal Aortic Aneurysms in Mice. Arterioscler Thromb Vasc Biol, 36: 69-77.
[17] Mizutani N, Nabe T, Yoshino S (2015). IgE/antigen-mediated enhancement of IgE production is a mechanism underlying the exacerbation of airway inflammation and remodelling in mice. Immunology, 144: 107-115.
[18] Wang J, Lindholt JS, Sukhova GK, Shi MA, Xia M, Chen H, et al. (2014). IgE actions on CD4+ T cells, mast cells, and macrophages participate in the pathogenesis of experimental abdominal aortic aneurysms. EMBO Mol Med, 6: 952-969.
[19] Hellmann DB, Grand DJ, Freischlag JA (2007). Inflammatory abdominal aortic aneurysm. JAMA, 297: 395-400.
[20] Shan H, Guo D, Li X, Zhao X, Li W, Bai X (2014). From autophagy to senescence and apoptosis in Angiotensin II-treated vascular endothelial cells. APMIS, 122: 985-992.
[21] Toczek J, Meadows JL, Sadeghi MM (2016). Novel Molecular Imaging Approaches to Abdominal Aortic Aneurysm Risk Stratification. Circ Cardiovasc Imaging, 9: e003023.
[22] Baxter BT, Terrin MC, Dalman RL (2008). Medical management of small abdominal aortic aneurysms. Circulation, 117: 1883-1889.
[23] Liao S, Curci JA, Kelley BJ, Sicard GA, Thompson RW (2000). Accelerated replicative senescence of medial smooth muscle cells derived from abdominal aortic aneurysms compared to the adjacent inferior mesenteric artery. J Surg Res, 92: 85-95.
[24] Yang F, Zhang H, Mei Y, Wu M (2014). Reciprocal regulation of HIF-1alpha and lincRNA-p21 modulates the Warburg effect. Mol Cell, 53: 88-100.
[25] Tang SS, Cheng J, Cai MY, Yang XL, Liu XG, Zheng BY, et al. (2016). Association of lincRNA-p21 Haplotype with Coronary Artery Disease in a Chinese Han Population. Dis Markers, 2016:9109743.
[1] Ma Linsha, Hu Jingchao, Cao Yu, Xie Yilin, Wang Hua, Fan Zhipeng, Zhang Chunmei, Wang Jinsong, Wu Chu-Tse, Wang Songlin. Maintained Properties of Aged Dental Pulp Stem Cells for Superior Periodontal Tissue Regeneration[J]. Aging and disease, 2019, 10(4): 793-806.
[2] Zhang Jie, Wang Yuqing, Aili Abudureyimujiang, Sun Xiuyuan, Pang Xuewen, Ge Qing, Zhang Yu, Jin Rong. Th1 Biased Progressive Autoimmunity in Aged Aire-Deficient Mice Accelerated Thymic Epithelial Cell Senescence[J]. Aging and disease, 2019, 10(3): 497-509.
[3] Chung Hae Young, Kim Dae Hyun, Lee Eun Kyeong, Chung Ki Wung, Chung Sangwoon, Lee Bonggi, Seo Arnold Y., Chung Jae Heun, Jung Young Suk, Im Eunok, Lee Jaewon, Kim Nam Deuk, Choi Yeon Ja, Im Dong Soon, Yu Byung Pal. Redefining Chronic Inflammation in Aging and Age-Related Diseases: Proposal of the Senoinflammation Concept[J]. Aging and disease, 2019, 10(2): 367-382.
[4] Murtha Lucy A., Morten Matthew, Schuliga Michael J., Mabotuwana Nishani S., Hardy Sean A., Waters David W., Burgess Janette K., Ngo Doan TM., Sverdlov Aaron L., Knight Darryl A., Boyle Andrew J.. The Role of Pathological Aging in Cardiac and Pulmonary Fibrosis[J]. Aging and disease, 2019, 10(2): 419-428.
[5] He Qing, Gao Yuhao, Wang Tongxing, Zhou Lujun, Zhou Wenxia, Yuan Zengqiang. Deficiency of Yes-Associated Protein Induces Cataract in Mice[J]. Aging and disease, 2019, 10(2): 293-306.
[6] Geraldo Rubens Ramos Freitas,Maria da Luz Fernandes,Fabiana Agena,Omar Jaluul,Sérgio Colenci Silva,Francine Brambate Carvalhinho Lemos,Verônica Coelho,David-Neto Elias,Nelson Zocoler Galante. Aging and End Stage Renal Disease Cause A Decrease in Absolute Circulating Lymphocyte Counts with A Shift to A Memory Profile and Diverge in Treg Population[J]. Aging and disease, 2019, 10(1): 49-61.
[7] Junfen Fan, Xingyan An, Yanlei Yang, Haoying Xu, Linyuan Fan, Luchan Deng, Tao Li, Xisheng Weng, Jianmin Zhang, Robert Chunhua Zhao. MiR-1292 Targets FZD4 to Regulate Senescence and Osteogenic Differentiation of Stem Cells in TE/SJ/Mesenchymal Tissue System via the Wnt/β-catenin Pathway[J]. Aging and disease, 2018, 9(6): 1103-1121.
[8] Patricia Sosa, Elena Alcalde-Estevez, Patricia Plaza, Nuria Troyano, Cristina Alonso, Laura Martinez-Arias, Andresa Evelem de Melo Aroeira, Diego Rodriguez-Puyol, Gemma Olmos, Susana Lopez-Ongil, Maria P. Ruiz-Torres. Hyperphosphatemia Promotes Senescence of Myoblasts by Impairing Autophagy Through Ilk Overexpression, A Possible Mechanism Involved in Sarcopenia[J]. Aging and disease, 2018, 9(5): 769-784.
[9] Brandenberger Christina, Kling Katharina Maria, Vital Marius, Christian Mühlfeld. The Role of Pulmonary and Systemic Immunosenescence in Acute Lung Injury[J]. Aging and disease, 2018, 9(4): 553-565.
[10] Lu Jiao, Duan Xuefeng, Zhao Wenming, Wang Jing, Wang Haoyu, Zhou Kai, Fang Min. Aged Mice are More Resistant to Influenza Virus Infection due to Reduced Inflammation and Lung Pathology[J]. Aging and disease, 2018, 9(3): 358-373.
[11] Wang Ningqun, Ji Shaozhen, Zhang Hao, Mei Shanshan, Qiao Lumin, Jin Xianglan. Herba Cistanches: Anti-aging[J]. Aging and disease, 2017, 8(6): 740-759.
[12] Stambler Ilia. Recognizing Degenerative Aging as a Treatable Medical Condition: Methodology and Policy[J]. Aging and disease, 2017, 8(5): 583-589.
[13] Tidwell Tia R., Søreide Kjetil, Hagland Hanne R.. Aging, Metabolism, and Cancer Development: from Peto’s Paradox to the Warburg Effect[J]. Aging and disease, 2017, 8(5): 662-676.
[14] Aunan Jan R., Cho William C, Søreide Kjetil. The Biology of Aging and Cancer: A Brief Overview of Shared and Divergent Molecular Hallmarks[J]. Aging and disease, 2017, 8(5): 628-642.
[15] Zinger Adar, Cho William C, Ben-Yehuda Arie. Cancer and Aging - the Inflammatory Connection[J]. Aging and disease, 2017, 8(5): 611-627.
Viewed
Full text


Abstract

Cited

  Shared   
Copyright © 2014 Aging and Disease, All Rights Reserved.
Address: Aging and Disease Editorial Office 3400 Camp Bowie Boulevard Fort Worth, TX76106 USA
Fax: (817) 735-0408 E-mail: editorial@aginganddisease.org
Powered by Beijing Magtech Co. Ltd