Please wait a minute...
 Home  About the Journal Editorial Board Aims & Scope Peer Review Policy Subscription Contact us
 
Early Edition  //  Current Issue  //  Open Special Issues  //  Archives  //  Most Read  //  Most Downloaded  //  Most Cited
Aging and disease    2020, Vol. 11 Issue (1) : 17-30     DOI: 10.14336/AD.2019.0512
Orginal Article |
Angelica Sinensis Polysaccharide Suppresses Epithelial-Mesenchymal Transition and Pulmonary Fibrosis via a DANCR/AUF-1/FOXO3 Regulatory Axis
Weibin Qian1,*, Xinrui Cai2,*, Qiuhai Qian3,*, Dongli Wang4, Lei Zhang5
1Department of Lung Disease, Affiliated Hospital of Shandong University of Traditional Chinese Medicine, Jinan, Shandong 250011, China.
2Department of Traditional Chinese Medicine, Shandong Academy of Occupational Health and Occupational Medicine, Shandong First Medical University & Shandong Academy of Medical Sciences, Jinan, Shandong 250062, China.
3Department of Endocrinology, Affiliated Hospital of Shandong University of Traditional Chinese Medicine, Jinan, Shandong 250011, China.
4Department of Personnel Section, Affiliated Hospital of Shandong University of Traditional Chinese Medicine, Jinan, Shandong 250011, China.
5Department of Cardiology, Affiliated Hospital of Shandong University of Traditional Chinese Medicine, Jinan, Shandong 250011, China
Download: PDF(1540 KB)   HTML
Export: BibTeX | EndNote | Reference Manager | ProCite | RefWorks    
Abstract  

Idiopathic pulmonary fibrosis (IPF) is characterized by the accumulation of lung fibroblasts and extracellular matrix deposition. Angelica sinensis polysaccharide (ASP), the major bioactive component that can extracted from roots of angelica, plays functional roles in immunomodulation, anti-tumor activity, and hematopoiesis. Emerging evidence has suggested that long noncoding RNAs (lncRNAs) play important roles in pathophysiological processes in various diseases. However, the roles of lncRNAs and ASP in IPF remain poorly understood. In the present study, we investigated the effects of ASP in IPF, as well as their functional interactions with lncRNA DANCR (differentiation antagonizing non-protein coding RNA). IPF models were established by treating Sprague-Dawley rats with BLM and treating alveolar type Ⅱ epithelial (RLE-6TN) cells with TGF-β1. Our results showed that ASP treatment suppressed pulmonary fibrosis in rats and fibrogenesis in RLE-6TN cells. The lncRNA DANCR is downregulated after ASP treatment in both rat lung tissues and RLE-6TN cells, and DANCR overexpression dramatically reversed the suppressive effects of ASP in IPF. Mechanistically, DANCR directly binds with AUF1 (AU-binding factor 1), thereby upregulating FOXO3 mRNA and protein levels. Moreover, overexpression of AUF1 or FOXO3 reversed the functional effects induced by ASP treatment. In conclusion, our findings showed that DANCR mediates ASP-induced suppression of IPF via upregulation of FOXO3 protein levels in an AUF1-dependent manner. Therefore, DANCR could serve as a promising therapeutic target in IPF treatment with ASP.

Keywords idiopathic pulmonary fibrosis      angelica sinensis polysaccharide      DANCR      AUF1      FOXO3     
Corresponding Authors: Weibin Qian,Xinrui Cai,Qiuhai Qian   
About author:

These authors contributed equally to this work.

Just Accepted Date: 13 May 2019   Issue Date: 15 January 2020
Service
E-mail this article
E-mail Alert
RSS
Articles by authors
Weibin Qian
Xinrui Cai
Qiuhai Qian
Dongli Wang
Lei Zhang
Cite this article:   
Weibin Qian,Xinrui Cai,Qiuhai Qian, et al. Angelica Sinensis Polysaccharide Suppresses Epithelial-Mesenchymal Transition and Pulmonary Fibrosis via a DANCR/AUF-1/FOXO3 Regulatory Axis[J]. Aging and disease, 2020, 11(1): 17-30.
URL:  
http://www.aginganddisease.org/EN/10.14336/AD.2019.0512     OR     http://www.aginganddisease.org/EN/Y2020/V11/I1/17
qPCR primer nameSequence (5’-3’)
DANCR (Forward)TCGGAGGTGGATTCTGTTAGG
DANCR (Reverse)TCGGTGTAGCAAGTCTGGTGA
FOXO3 (Forward)CTCCACCCCTGCTGAGATGAT
FOXO3 (Reverse)AGTGAGAACGTTGTCCCGCGCTGG
GAPDH (Forward)GCACCGTCAAGGCTGAGAAC
GAPDH (Reverse)ATGGTGGTGAAGACGCCAGT
U6 (Forward)CTCGCTTCGGCAGCACA
U6 (Reverse)AACGCTTCACGAATTTGCGT
U1 (Forward)GGGAGATACCATGATCACGAAGGT
U1 (Reverse)
Silencing RNA name
CCACAAATTATGCAGTCGAGTTTCCC
Sequence (5’-3’)
si-AUF1
si-FOXO3 si-NC
UCGACUAUCUGCUCCAAG
TGATCAGCCTCAATCTGCA GACCTACAACTACCTATCA
Table 1  Information of the qPCR primer sequences and silencing RNA sequences.
Figure 1.  ASP treatment inhibits pulmonary fibrosis in vivo and cell fibrogenesis in vitro. (A) H&E and Masson’s staining assays were performed to demonstrate the effects of BLM and ASP on pulmonary fibrosis of rat lung tissues. Immunohistochemical analysis of collagen-1 protein levels in rat lung tissues. (B) Morphological changes in RLE-6TN cells, such as disappearance of intercellular junction and spindle-like structures (indicated by arrows), were observed after treatment with TGF-β1. (C) Cell proliferation was evaluated by performing CCK8 assay in the different sample groups, *P<0.05. (D) Transwell assay was performed to detect the migration of RLE-6TN cells, *P<0.05. (E) The expression levels of E-cadherin and α-SMA in RLE-6TN cells were measured by western blotting. Protein expression levels relative to β-actin levels are shown, **P<0.01.
Figure 2.  LncRNA DANCR is essential for ASP-induced suppression of fibrogenesis. (A-B) qRT-PCR was performed to determine the expression levels of DANCR in RLE-6TN cells (A) and rat lung tissues (B), which are treated with or without ASP, *P<0.05, **P<0.01. (C) DANCR was overexpressed in RLE-6TN cells by infection with DANCR-specific plasmid, ***P<0.001. (D) CCK8 assay revealed that DANCR overexpression attenuated ASP-induced suppression of cell proliferation, *P<0.05. (E) Results of Transwell assay showed that ASP suppressed cell migration of RLE-6TN cells; however, transfection with DANCR reversed this effect, *P<0.05. (F) Immunofluorescence assays showed that upregulation of DANCR levels abrogated the ASP-induced inhibition of collagen-1, E-cadherin, and α-SMA expression. Green fluorescence represents respective proteins (collagen-1, E-cadherin, and α-SMA), and blue fluorescence indicates nuclei stained by DAPI. (G) qPCR analysis was performed to evaluate the upregulation of DANCR levels in rats administered with p-DANCR compared to those in control rats, **P<0.01. (H) H&E and Masson’s staining assays were performed to investigate the effects of DANCR in ASP-induced suppression of pulmonary fibrosis in rat lung tissues; immunohistochemical analysis of collagen-1 protein expression in rat lung tissues overexpressing DANCR.
Figure 3.  DANCR regulates fibrogenesis by inducing FOXO3 expression. (A) Heatmap showing mRNA expression levels in RLE-6TN cells transfected with control or DANCR plasmid for 48 h. Arrow indicates FOXO3. (B) FOXO3 expression was measured by western blot analysis in cells overexpressing DANCR. (C) FOXO3 protein levels in rat lung tissues were analyzed by immunohistochemistry. (D) FOXO3 mRNA expression was detected in RLE-6TN cells (left panel) and rat lung tissues (right panel) by qRT-PCR. (E) Immunohistochemical analysis of FOXO3 levels in lung tissues treated with ASP or PBS control. (F) Western blot assay was performed to detect FOXO3 protein levels in RLE-6TN cells treated with ASP or PBS control. (G) FOXO3 expression was silenced in RLE-6TN cells by transfection with FOXO3 siRNA, **P<0.01. (H) Relative cell proliferation was measured by CCK8 assay in cells overexpressing DANCR and (or) FOXO3 knockdown cells, *P<0.05. (I) Cell migration was evaluated by Transwell assay in cells overexpressing DANCR and (or) FOXO3 knockdown cells, **P<0.01. (J) Effect of FOXO3 and DANCR on the expression of EMT-related proteins were identified by western blotting.
Figure 4.  LncRNA DANCR is associated with AUF1 in RLE-6TN cells. (A) Nuclear fraction experiments and qRT-PCR experiments were performed to determine the relative distribution of DANCR in nucleus and cytoplasm of RLE-6TN cells. (B) The distribution of DANCR was determined by performing RNA fluorescence in situ hybridization (FISH) in RLE-6TN cells. (C) Prediction of 350-670-nt DANCR structures based on minimum free energy (MFE) and partition function (http://rna.tbi.univie.ac.at/). (D) Immunofluorescence assay was performed to identify the subcellular distribution of AUF1 proteins in RLE-6TN cells. (E) RNA pulldown followed by western blotting was performed with DANCR probe to verify the direct interaction between AUF1 and DANCR. GAPDH was used as the internal control. (F) RNA immunoprecipitation (RIP) was performed with an anti-AUF1 antibody to identify the association between DANCR and AUF1. Enrichment was shown as the percentage of input, ***P<0.001.
Figure 5.  DANCR promotes translation of FOXO3 gene by binding to AUF1. (A) RIP was performed using anti-AUF1 and control IgG antibodies, followed by qRT-PCR to determine the enrichment of DANCR and U6. U6 was used as the negative control, **P<0.01. (B) Experimental validation of AUF1 knockdown in RLE-6TN cells by qRT-PCR and western blotting, ***P<0.001. (C) mRNA and protein levels of FOXO3 in RLE-6TN cells silenced with AUF1. (D) Western blotting was performed to detect the protein expression levels of FOXO3 in RLE-6TN cells overexpressing DANCR or (and) silenced with AUF1. (E) RLE-6TN lysates were incubated with in vitro-synthesized, biotin-labeled control LacZ DNA probes or DNA probes against DANCR for the biotinylated oligonucleotide pulldown assay. **P<0.01 compared to respective LacZ probes. (F) Endogenous AUF1 binding to FOXO3 mRNA was modified by DANCR overexpression, **P<0.01. (G) Control plasmids or DANCR plasmids transfected RLE-6TN cells were cultured with 20 μg/ml cycloheximide (CHX) for 0-150 min and analyzed by western blotting.
Figure 6.  ASP suppresses fibrogenesis by regulating the DANCR/AUF1/FOXO3 axis. (A) AUF1 overexpression was validated by qRT-PCR and western blotting, ***P<0.001. (B) Cell proliferation was measured by CCK8 assay in cells treated with ASP and (or) p-AUF1, *P<0.05. (C) Cell migration was evaluated by Transwell assay in cells treated with ASP and(or) p-AUF1, *P<0.05. (D) Expression of EMT-relevant proteins, E-cadherin, and α-SMA were detected by western blot experiments in cells treated with ASP and (or) AUF1 plasmid. (E) Cell proliferation was measured by CCK8 assay in cells treated with ASP and (or) p-AUF1, *P<0.05. (F) Cell migration was evaluated by Transwell assay in cells treated with ASP and (or) p-AUF1, *P<0.05. (G) Expression levels of EMT-relevant proteins, E-cadherin, and α-SMA, were detected by western blot experiment in cells treated with ASP and (or) AUF1 plasmid.
ProteinBeadsDANCRRatio (DANCR/Beads)
AUF103NA
STT3B03NA
ARF603NA
DPM1133
SMAD403NA
LAS1L133
AKAP803NA
GSTO103NA
ZEB203NA
PCH203NA
Table 2  Identification of DANCR binding proteins by MS.
Figure 7.  Schematic showing the proposed regulatory mechanisms of ASP. ASP treatment upregulated DANCR expression. DANCR overexpression upregulates FOXO3 expression by guiding AUF1 to activate the translation of FOXO3 mRNA, thereby promoting proliferation, migration, and the EMT and initiation of pulmonary fibrosis.
[1] Jacob J, Bartholmai BJ, Rajagopalan S, Karwoski R, Nair A, Walsh SLF, et al. (2018). Likelihood of pulmonary hypertension in patients with idiopathic pulmonary fibrosis and emphysema. Respirology, 23:593-599.
[2] Diaz-Pina G, Ordonez-Razo RM, Montes E, Paramo I, Becerril C, Salgado A, et al. (2018). The Role of ADAR1 and ADAR2 in the Regulation of miRNA-21 in Idiopathic Pulmonary Fibrosis. Lung, 196:393-400.
[3] Willis BC, Liebler JM, Luby-Phelps K, Nicholson AG, Crandall ED, du Bois RM, et al. (2005). Induction of epithelial-mesenchymal transition in alveolar epithelial cells by transforming growth factor-beta1: potential role in idiopathic pulmonary fibrosis. Am J Pathol, 166:1321-1332.
[4] Wei WL, Zeng R, Gu CM, Qu Y, Huang LF (2016). Angelica sinensis in China-A review of botanical profile, ethnopharmacology, phytochemistry and chemical analysis. J Ethnopharmacol, 190:116-141.
[5] Jin M, Zhao K, Huang Q, Xu C, Shang P (2012). Isolation, structure and bioactivities of the polysaccharides from Angelica sinensis (Oliv.) Diels: a review. Carbohydr Polym, 89:713-722.
[6] Wang K, Wu J, Xu J, Gu S, Li Q, Cao P, et al. (2018). Correction of Anemia in Chronic Kidney Disease With Angelica sinensis Polysaccharide via Restoring EPO Production and Improving Iron Availability. Front Pharmacol, 9:803.
[7] Yang J, Shao X, Jiang J, Sun Y, Wang L, Sun L (2018). Angelica sinensis polysaccharide inhibits proliferation, migration, and invasion by downregulating microRNA-675 in human neuroblastoma cell line SH-SY5Y. Cell Biol Int, 42:867-876.
[8] Zhuang C, Wang Y, Zhang Y, Xu N (2018). Oxidative stress in osteoarthritis and antioxidant effect of polysaccharide from angelica sinensis. Int J Biol Macromol, 115:281-286.
[9] Loewen G, Jayawickramarajah J, Zhuo Y, Shan B (2014). Functions of lncRNA HOTAIR in lung cancer. J Hematol Oncol, 7:90.
[10] Fatica A, Bozzoni I (2014). Long non-coding RNAs: new players in cell differentiation and development. Nat Rev Genet, 15:7-21.
[11] Nakagawa S, Kageyama Y (2014). Nuclear lncRNAs as epigenetic regulators-beyond skepticism. Biochim Biophys Acta, 1839:215-222.
[12] Kornienko AE, Guenzl PM, Barlow DP, Pauler FM (2013). Gene regulation by the act of long non-coding RNA transcription. BMC Biol, 11:59.
[13] Ni W, Zhang Y, Zhan Z, Ye F, Liang Y, Huang J, et al. (2017). A novel lncRNA uc.134 represses hepatocellular carcinoma progression by inhibiting CUL4A-mediated ubiquitination of LATS1. J Hematol Oncol, 10:91.
[14] Wang N, Yu Y, Xu B, Zhang M, Li Q, Miao L (2019). Pivotal prognostic and diagnostic role of the long noncoding RNA colon cancerassociated transcript 1 expression in human cancer (Review). Mol Med Rep, 19:771-782.
[15] Sallam T, Sandhu J, Tontonoz P (2018). Long Noncoding RNA Discovery in Cardiovascular Disease: Decoding Form to Function. Circ Res, 122:155-166.
[16] Zhao X, Sun J, Chen Y, Su W, Shan H, Li Y, et al. (2018). lncRNA PFAR Promotes Lung Fibroblast Activation and Fibrosis by Targeting miR-138 to Regulate the YAP1-Twist Axis. Mol Ther, 26:2206-2217.
[17] Song X, Xu P, Meng C, Song C, Blackwell TS, Li R, et al. (2019). lncITPF Promotes Pulmonary Fibrosis by Targeting hnRNP-L Depending on Its Host Gene ITGBL1. Mol Ther, 27:380-393.
[18] Jiang H, Chen Y, Yu T, Zhao X, Shan H, Sun J, et al. (2018). Inhibition of lncRNA PFRL prevents pulmonary fibrosis by disrupting the miR-26a/smad2 loop. Am J Physiol Lung Cell Mol Physiol, 315:L563-L575.
[19] Li X, Yu T, Shan H, Jiang H, Sun J, Zhao X, et al. (2018). lncRNA PFAL promotes lung fibrosis through CTGF by competitively binding miR-18a. FASEB J, 32:5285-5297.
[20] Kretz M, Webster DE, Flockhart RJ, Lee CS, Zehnder A, Lopez-Pajares V, et al. (2012). Suppression of progenitor differentiation requires the long noncoding RNA ANCR. Genes Dev, 26:338-343.
[21] Lu QC, Rui ZH, Guo ZL, Xie W, Shan S, Ren T (2018). LncRNA-DANCR contributes to lung adenocarcinoma progression by sponging miR-496 to modulate mTOR expression. J Cell Mol Med, 22:1527-1537.
[22] Yuan SX, Wang J, Yang F, Tao QF, Zhang J, Wang LL, et al. (2016). Long noncoding RNA DANCR increases stemness features of hepatocellular carcinoma by derepression of CTNNB1. Hepatology, 63:499-511.
[23] Zhang L, Yang C, Chen S, Wang G, Shi B, Tao X, et al. (2017). Long Noncoding RNA DANCR Is a Positive Regulator of Proliferation and Chondrogenic Differentiation in Human Synovium-Derived Stem Cells. DNA Cell Biol, 36:136-142.
[24] Zhu L, Xu PC (2013). Downregulated LncRNA-ANCR promotes osteoblast differentiation by targeting EZH2 and regulating Runx2 expression. Biochem Biophys Res Commun, 432:612-617.
[25] Jia J, Li F, Tang XS, Xu S, Gao Y, Shi Q, et al. (2016). Long noncoding RNA DANCR promotes invasion of prostate cancer through epigenetically silencing expression of TIMP2/3. Oncotarget, 7:37868-37881.
[26] Ghatak S, Hascall VC, Markwald RR, Feghali-Bostwick C, Artlett CM, Gooz M, et al. (2017). Transforming growth factor beta1 (TGFbeta1)-induced CD44V6-NOX4 signaling in pathogenesis of idiopathic pulmonary fibrosis. J Biol Chem, 292:10490-10519.
[27] Qian W, Cai X, Qian Q, Zhang W, Wang D (2018). Astragaloside IV modulates TGF-beta1-dependent epithelial-mesenchymal transition in bleomycin-induced pulmonary fibrosis. J Cell Mol Med, 22:4354-4365.
[28] Qian W, Cai X, Qian Q, Peng W, Yu J, Zhang X, et al. (2019). lncRNA ZEB1-AS1 promotes pulmonary fibrosis through ZEB1-mediated epithelial-mesenchymal transition by competitively binding miR-141-3p. Cell Death Dis, 10:129.
[29] Xu SY, Huang X, Cheong KL (2017). Recent Advances in Marine Algae Polysaccharides: Isolation, Structure, and Activities. Mar Drugs, 15.
[30] Belguise K, Guo S, Sonenshein GE (2007). Activation of FOXO3a by the green tea polyphenol epigallocatechin-3-gallate induces estrogen receptor alpha expression reversing invasive phenotype of breast cancer cells. Cancer Res, 67:5763-5770.
[31] Chen DL, Lu YX, Zhang JX, Wei XL, Wang F, Zeng ZL, et al. (2017). Long non-coding RNA UICLM promotes colorectal cancer liver metastasis by acting as a ceRNA for microRNA-215 to regulate ZEB2 expression. Theranostics, 7:4836-4849.
[32] Moore AE, Chenette DM, Larkin LC, Schneider RJ (2014). Physiological networks and disease functions of RNA-binding protein AUF1. Wiley Interdiscip Rev RNA, 5:549-564.
[33] Pretner E, Amri H, Li W, Brown R, Lin CS, Makariou E, et al. (2006). Cancer-related overexpression of the peripheral-type benzodiazepine receptor and cytostatic anticancer effects of Ginkgo biloba extract (EGb 761). Anticancer Res, 26:9-22.
[34] Liao KF, Chiu TL, Huang SY, Hsieh TF, Chang SF, Ruan JW, et al. (2018). Anti-Cancer Effects of Radix Angelica Sinensis (Danggui) and N-Butylidenephthalide on Gastric Cancer: Implications for REDD1 Activation and mTOR Inhibition. Cell Physiol Biochem, 48:2231-2246.
[35] Ye YN, So HL, Liu ES, Shin VY, Cho CH (2003). Effect of polysaccharides from Angelica sinensis on gastric ulcer healing. Life Sci, 72:925-932.
[36] Wang R, Ibarra-Sunga O, Verlinski L, Pick R, Uhal BD (2000). Abrogation of bleomycin-induced epithelial apoptosis and lung fibrosis by captopril or by a caspase inhibitor. Am J Physiol Lung Cell Mol Physiol, 279:L143-151.
[37] Ulitsky I, Bartel DP (2013). lincRNAs: genomics, evolution, and mechanisms. Cell, 154:26-46.
[38] Wang Y, Zeng X, Wang N, Zhao W, Zhang X, Teng S, et al. (2018). Long noncoding RNA DANCR, working as a competitive endogenous RNA, promotes ROCK1-mediated proliferation and metastasis via decoying of miR-335-5p and miR-1972 in osteosarcoma. Mol Cancer, 17:89.
[39] Wang Y, Lu Z, Wang N, Feng J, Zhang J, Luan L, et al. (2018). Long noncoding RNA DANCR promotes colorectal cancer proliferation and metastasis via miR-577 sponging. Exp Mol Med, 50:57.
[40] Yang JX, Sun Y, Gao L, Meng Q, Yang BY (2018). Long non-coding RNA DANCR facilitates glioma malignancy by sponging miR-33a-5p. Neoplasma, 65:790-798.
[41] Batista PJ, Chang HY (2013). Long noncoding RNAs: cellular address codes in development and disease. Cell, 152:1298-1307.
[42] Choi YJ, Yoon JH, Chang JH (2016). Crystal Structure of the N-Terminal RNA Recognition Motif of mRNA Decay Regulator AUF1. Biomed Res Int, 2016: 3286191.
[43] Velagapudi SP, Cameron MD, Haga CL, Rosenberg LH, Lafitte M, Duckett DR, et al. (2016). Design of a small molecule against an oncogenic noncoding RNA. Proc Natl Acad Sci U S A, 113:5898-5903.
[44] Disney MD, Angelbello AJ (2016). Rational Design of Small Molecules Targeting Oncogenic Noncoding RNAs from Sequence. Acc Chem Res, 49:2698-2704.
No related articles found!
Viewed
Full text


Abstract

Cited

  Shared   
Copyright © 2014 Aging and Disease, All Rights Reserved.
Address: Aging and Disease Editorial Office 3400 Camp Bowie Boulevard Fort Worth, TX76106 USA
Fax: (817) 735-0408 E-mail: editorial@aginganddisease.org
Powered by Beijing Magtech Co. Ltd