Please wait a minute...
 Home  About the Journal Editorial Board Aims & Scope Peer Review Policy Subscription Contact us
 
Early Edition  //  Current Issue  //  Open Special Issues  //  Archives  //  Most Read  //  Most Downloaded  //  Most Cited
Aging and disease    2019, Vol. 10 Issue (6) : 1187-1198     DOI: 10.14336/AD.2019.0515
Orginal Article |
Astragalus Polysaccharide Extends Lifespan via Mitigating Endoplasmic Reticulum Stress in the Silkworm, Bombyx mori
Jiangbo Song, Min Chen, Zhiquan Li, Jianfei Zhang, Hai Hu, Xiaoling Tong*, Fangyin Dai*
State Key Laboratory of Silkworm Genome Biology, Key Laboratory for Sericulture Biology and Genetic Breeding, Ministry of Agriculture and Rural Affairs, College of Biotechnology, Southwest University, Chongqing 400716, China
Download: PDF(964 KB)   HTML
Export: BibTeX | EndNote | Reference Manager | ProCite | RefWorks    
Abstract  

The traditional Chinese medicine Astragalus polysaccharide (APS) has been widely used to improve glucose homeostasis and immunoregulator properties. In recent years, it has also been shown to extend the lifespan of Caenorhabditis elegans; however, the underlying molecular mechanisms are not fully understood. Here, our study shows that APS could significantly extend adult stage, mean, and maximum lifespan of the silkworm, Bombyx mori and increase body weight without affecting food intake and fecundity. Meanwhile, the activities of glutathione S-transferase and superoxide dismutase are significantly enhanced, and the reaction oxygen species content is reduced concomitantly. Moreover, the activity of lysozyme is increased dramatically. In addition, APS rescues the shortened lifespan by Bacillus thuringiensis infection in silkworm. Furthermore, the transcription of the crucial genes involved in endoplasmic reticulum stress is upregulated upon the endoplasmic reticulum stress stimulation. APS also significantly ameliorates endoplasmic reticulum stress in silkworm cell line and in vivo. Together, the results of this study indicate that APS can prolong the silkworm lifespan by mitigating endoplasmic reticulum stress. This study improves our understanding of the molecular mechanism of APS-induced lifespan extension and highlights the importance of the silkworm as an experimental animal for evaluating the effects and revealing the mechanisms in lifespan extension of traditional Chinese medicine.

Keywords astragalus polysaccharide      silkworm      experimental animal      drug efficacy      lifespan      endoplasmic reticulum stress     
Corresponding Authors: Tong Xiaoling,Dai Fangyin   
About author: These authors contributed equally to this work.
Just Accepted Date: 22 May 2019   Issue Date: 16 November 2019
Service
E-mail this article
E-mail Alert
RSS
Articles by authors
Song Jiangbo
Chen Min
Li Zhiquan
Zhang Jianfei
Hu Hai
Tong Xiaoling
Dai Fangyin
Cite this article:   
Song Jiangbo,Chen Min,Li Zhiquan, et al. Astragalus Polysaccharide Extends Lifespan via Mitigating Endoplasmic Reticulum Stress in the Silkworm, Bombyx mori[J]. Aging and disease, 2019, 10(6): 1187-1198.
URL:  
http://www.aginganddisease.org/EN/10.14336/AD.2019.0515     OR     http://www.aginganddisease.org/EN/Y2019/V10/I6/1187
Primer nameF primer (5’ - 3’)R primer (5’ -3’)
sw22934TTCGTACTGCTCTTCTCGCAAAGTTGATAGCAATTCCCT
BmATF4CGTCGCCCTAACCGTATCATCCAGTCTTCCACCGCATTCT
BmATF6GAGTCGTTGGATTAGAGGAGGCGATGTTACGCACCTGATTTCTTG
BmBipCCGCCCTTTAACTTTCCACTCGACACGCTGCCGTCGCTA
BmeIF2αCATCACAGAGGCAGGTGGAGTCAGCGAGTTCAGCGTTTTCA
BmPERKTGGCTTTGGCGTTAGTCTTGTTCTCGGATGGTATGTCCTCGTT
BmIRE1GTTGGGCTGCGTGTTCTATTACAGAACATCGGGTATTTCAGTATCG
BmFoxOGCACAGGACAACAGGCTCACACGCTTGGCGTCGGGATTGA
BmHSP70CTCTCGCTGACCAGGATGAATTTCGACAGTGGGTCCATCATT
BmHSP90TCCCAGTTCATTGGCTACCCTTGACTGCAAGATGGTCCTCC
BmTRAP1GATTCTCATCCTTGCGTCATTGTTGTTCGCTAGTTCCTTGTCAGTC
Table 1  The primer sets used in this study for RT-qPCR.
Figure 1.  The effective concentration of APS. (A-D) Survival curves of different APS concentrations in female and male silkworms. Log-rank test (Mantel-Cox) and Student’s t-test (two tailed) were used to evaluate the difference between the treatment and control groups. *p<0.05. **p<0.01. ***p<0.001.
Figure 2.  Effect of APS on the lifespan of the silkworm. (A) Unmated females treated with APS (mean lifespan=41.0 d, n=33) lived longer than control female silkworms (mean lifespan= 39.5 d, n=36), p<0.001; (B) There was no significant difference between unmated males treated with APS (mean lifespan=37.96 d, n=42) and control male silkworms (mean lifespan=37.72 d, n=37), p=0.51. C. Unmated females treated with APS (maximum lifespan=43.79 d, n=4) lived longer than control female silkworms (maximum lifespan=41.28 d, n=4), p=0.0001; (D) There were no significant differences between unmated males treated with APS. (E) The maximum lifespan of treatment and control in female and male silkworm. Log-rank test (Mantel-Cox) and Student’s t-test (two tailed) were employed to evaluate the significance between the control and treatment groups. *p<0.05. **p<0.01. ***p<0.001. n.s., not significant.
Figure 3.  Effect of APS on the diet, weight, and fecundity of the silkworm. (A-B) The impact on food intake of female and male silkworm chronically exposed to APS (n=20); (C) The impact on body weight of female silkworm chronically exposed to APS, L5D1 (meanCtrl =0.338 g, meanAPS=0.351 g, p=0.306, n=20), L5D5 (meanCtrl =1.618 g, meanAPS=1.662 g, p=0.025, n=20), P3 (meanCtrl =0.765 g, meanAPS=0.816 g, p=0.039, n=8); (D) The impact on the body weight of male silkworm chronically exposed to APS or respective controls, L5D1 (meanCtrl =0.274 g, meanAPS=0.278 g, p=0.69, n=20), L5D5 (meanCtrl =1.451 g, meanAPS=1.467 g, p=0.93, n=20), P3 (meanCtrl =0.552 g, meanAPS=0.604 g, p=0.020, n=9). Student’s t-test (two tailed) were employed to evaluate the significance. *p<0.05. n.s., not significant. (E) There were no significant differences between females treated with APS (fecundity =329, n=41) and control female silkworms (fecundity =333, n=46), p=0.635. Student’s t-test (two tailed) were employed to evaluate the significance. n.s., not significant.
Figure 4.  Effects of APS on SOD and GST activity, and the content of MDA and ROS in the silkworm. (A) The standard curves of the SOD, the SOD activity of the fifth larval silkworm after 0.1% APS chronically treatment, L5D1 (Student’s t-test, two-tailed, n=9), L5D3 (Student’s t-test, two-tailed, n=9), L5D5 (Student’s t-test, two-tailed, n=9). (B) The standard curves of the GST, the GST activity of the fifth larval silkworm after 0.1% APS chronically treatment, L5D1 (Student’s t-test, two-tailed, n=9), L5D3 (Student’s t-test, two-tailed, n=9), L5D5 (Student’s t-test, two-tailed, n=9). (C) The standard curves of the MDA, the MDA content of the fifth larval silkworm after 0.1% APS chronically treatment, L5D1 (Student’s t-test, two-tailed, n=9), L5D3 (Student’s t-test, two-tailed, n=9), L5D5 (Student’s t-test, two-tailed, n=9). (D-E) The ROS content of the fifth larval silkworm after 0.1% APS chronically treatment, L5D3 (Student’s t-test, two-tailed, n=9), L5D5 (Student’s t-test, two-tailed, n=9).
Figure 5.  Effect of APS on Att and lysozyme content, and survival condition in the silkworm. (A) Attacin content on day 3 of fifth instar larvae silkworm hemolymph after 0.1% APS chronic treatment, female (Student’s t-test, two-tailed, n=7), male (Student’s t-test, two-tailed, n=7). (B and C) Lysozyme content on day 3 of fifth instar larvae silkworm hemolymph after 0.1% APS chronic treatment in female and males (Student’s t-test, two-tailed, n=7); (D and E) Survival rates of Bacillus thuringiensis (BT)-infected silkworms after chronic exposures to APS, Log-rank test (Mantel-Cox), Female (n=7), Male (n=7).
Figure 6.  Effects of APS on thapsigargin-induced ERS in BmN-SWU1 cells. (A) Expression levels of ERS-related genes in BmN-SWU1 cells treated with thapsigargin (n=6); (B and C) Effects of APS on the expression levels of BmBip and BmPERK in BmN-SWU1 cells after thapsigargin treatment (n=6); (D-I) Effects of APS on the expression levels of BmATF6, BmBip, and BmPERK in female and male silkworms (n=9). Student’s t-test, two-tailed, *** p<0.001; ** p<0.01; *p<0.05.
Figure 7.  A model illustrating that APS extends lifespan via mitigating ER homeostasis by restricting Bip-PERK pathway activity.
[1] Liu P, Zhao H, Luo Y (2017). Anti-Aging Implications of Astragalus Membranaceus (Huangqi): A Well-Known Chinese Tonic. Aging Dis, 8:868-886.
[2] Chen Y, Wang D, Hu Y, Guo Z, Wang J, Zhao X, et al. (2010). Astragalus polysaccharide and oxymatrine can synergistically improve the immune efficacy of Newcastle disease vaccine in chicken. Int J Biol Macromol, 46:425-428.
[3] Huang X, Wang D, Hu Y, Lu Y, Guo Z, Kong X, et al. (2008). Effect of sulfated astragalus polysaccharide on cellular infectivity of infectious bursal disease virus. Int J Biol Macromol, 42:166-171.
[4] Jiang JB, Wu CH, Gao H, Song JD, Li HQ (2010). Effects of astragalus polysaccharides on immunologic function of erythrocyte in chickens infected with infectious bursa disease virus. Vaccine, 28:5614-5616.
[5] Zhang R, Qin X, Zhang T, Li Q, Zhang J, Zhao J (2018). Astragalus Polysaccharide Improves Insulin Sensitivity via AMPK Activation in 3T3-L1 Adipocytes. Molecules, 23:pii: E2711.
[6] Li H, Shi R, Ding F, Wang H, Han W, Ma F, et al. (2016). Astragalus Polysaccharide Suppresses 6-Hydroxydopamine-Induced Neurotoxicity in Caenorhabditis elegans. Oxid Med Cell Longev, 2016:4856761.
[7] Zhang H, Pan N, Xiong S, Zou S, Li H, Xiao L, et al. (2012). Inhibition of polyglutamine-mediated proteotoxicity by Astragalus membranaceus polysaccharide through the DAF-16/FOXO transcription factor in Caenorhabditis elegans. Biochem J, 441:417-424.
[8] Li J, Bao Y, Waikei L, Li W, Lu F, Zhu X, et al. (2008). Immunoregulatory and Anti-Tumor Effects of Polysaccharopeptide and Astragalus polysaccharides on Tumor-Bearing Mice. Immunopharmacol Immunotoxicol, 30:771-782.
[9] Zhou R, Chen H, Chen J, Chen X, Yu W, Xu L (2018). Extract from Astragalus membranaceus inhibit breast cancer cells proliferation via PI3K/AKT/mTOR signaling pathway. BMC Complement Altern Med, 18:83.
[10] Wu J, Wang J, Su Q, Ding W, Li T, Yu J, et al. (2018). Traditional Chinese medicine Astragalus polysaccharide enhanced antitumor effects of the angiogenesis inhibitor apatinib in pancreatic cancer cells on proliferation, invasiveness, and apoptosis. Onco Targets Ther, 11:2685-2698.
[11] Li X, Zhang Y, Kuang H, Jin F, Liu D, Gao M, et al. (2012). Mitochondrial protection and anti-aging activity of Astragalus polysaccharides and their potential mechanism. Int J Mol Sci, 13:1747-1761.
[12] Zhao H, Luo Y (2017). Traditional Chinese Medicine and Aging Intervention. Aging Dis, 8:688-690.
[13] Zou F, Mao X, Wang N, Liu J, OUyang J (2009). Astragalus polysaccharides alleviates glucose toxicity and restores glucose homeostasis in diabetic states via activation of AMPK. Acta Pharmacol Sin, 30:1607-1615.
[14] Wang N, Zhang DL, Mao XQ, Zou F, Jin H, Ouyang JP (2009). Astragalus polysaccharides decreased the expression of PTP1B through relieving ER stress induced activation of ATF6 in a rat model of type 2 diabetes. Mol Cell Endocrinol, 307:89-98.
[15] Wang N, Liu J, Xie F, Gao X, Ye J, Sun L, et al. (2015). miR-124/ATF-6, a novel lifespan extension pathway of Astragalus polysaccharide in Caenorhabditis elegans. J Cell Biochem, 116:242-251.
[16] Zhang K, Kaufman RJ (2006). Protein folding in the endoplasmic reticulum and the unfolded protein response. In: Starke K Gaestel M (eds) Molecular Chaperones in Health and Disease. Handbook of Experimental Pharmacology, vol 172. Springer, Berlin, Heidelberg, 18:69-91.
[17] Wolfson JJ, May KL, Thorpe CM, Jandhyala DM, Paton JC, Paton AW (2008). Subtilase cytotoxin activates PERK, IRE1 and ATF6 endoplasmic reticulum stress-signalling pathways. Cell Microbiol, 10:1775-1786.
[18] Hassan I, Gaines KS, Hottel WJ, Wishy RM, Miller SE, Powers LS, et al. (2014). Inositol-requiring enzyme 1 inhibits respiratory syncytial virus replication. J Biol Chem, 289:7537-7546.
[19] Salminen A, Kaarniranta K (2010). ER stress and hormetic regulation of the aging process. Ageing Res Rev, 9:211-217.
[20] Labunskyy V, Gerashchenko M, Delaney J, Kaya A, Kennedy B, Kaeberlein M, et al. (2014). Lifespan extension conferred by endoplasmic reticulum secretory pathway deficiency requires induction of the unfolded protein response. PLoS Genet, 10:e1004019.
[21] Steffen KK, McCormick MA, Pham KM, MacKay VL, Delaney JR, Murakami CJ, et al. (2012). Ribosome deficiency protects against ER stress in Saccharomyces cerevisiae. Genetics, 191:107-118.
[22] Johnson T, Henderson S, Murakami S, de Castro E, de Castro S, Cypser J, et al. (2002). Longevity genes in the nematode Caenorhabditis elegans also mediate increased resistance to stress and prevent disease. J Inherit Metab Dis, 25:197-206.
[23] Dorman JB, Albinder B, Shroyer T, Kenyon C (1995). The age-1 and daf-2 genes function in a common pathway to control the lifespan of Caenorhabditis elegans. Genetics, 141:1399-1406.
[24] Song J, Tang D, Li Z, Tong X, Zhang J, Han M, et al. (2016). Variation of lifespan in multiple strains, and effects of dietary restriction and BmFoxO on lifespan in silkworm, Bombyx mori. Oncotarget, 8:7294-7300.
[25] Henis Korenblit S, Zhang P, Hansen M, McCormick M, Lee SJ, Cary M, et al. (2010). Insulin/IGF-1 signaling mutants reprogram ER stress response regulators to promote longevity. Proc Natl Acad Sci U S A, 107:9730-9735.
[26] Hamamoto H, Tonoike A, Narushima K, Horie R, Sekimizu K (2009). Silkworm as a model animal to evaluate drug candidate toxicity and metabolism. Comp Biochem Physiol C Toxicol Pharmacol, 149:334-339.
[27] Matsumoto Y, Sumiya E, Sugita T, Sekimizu K (2011). An invertebrate hyperglycemic model for the identification of anti-diabetic drugs. PloS One, 6:e18292.
[28] Zhang X, Xue R, Cao G, Pan Z, Zheng X, Gong C (2012). Silkworms Can be Used as an Animal Model to Screen and Evaluate Gouty Therapeutic Drugs. J Insect Sci, 12:1-9.
[29] Folch J, Busquets O, Ettcheto M, Sánchez-López E, Pallãs M, Beas-Zarate C, et al. (2017). Experimental models for aging and their potential for novel drug discovery. Curr Neuropharmacol, 16:1466-1483.
[30] Song J, Zhang J, Dai F (2018). Advantages and limitations of silkworm as an invertebrate model in aging and lifespan research. Open Access J Gerontol Geriatr Med, 4:ID.555641.
[31] Chen C, Song J, Chen M, Li Z, Tong X, Hu H, et al. (2016). Rhodiola rosea extends lifespan and improves stress tolerance in silkworm, Bombyx mori. Biogerontology, 17:373-381.
[32] Wang G, Xia Q, Cheng D, Duan J, Zhao P, Chen J, et al. (2008). Reference genes identified in the silkworm Bombyx mori during metamorphism based on oligonucleotide microarray and confirmed by qRT-PCR. Insect Sci, 15:405-413.
[33] Colman R, Anderson R, Johnson S, Kastman E, Kosmatka K, Beasley T, et al. (2009). Caloric restriction delays disease onset and mortality in rhesus monkeys. Science, 325:201-204.
[34] Piper MD, Bartke A (2008). Diet and Aging. Cell Metab, 8:99-104.
[35] Kenyon CJ (2010). The genetics of ageing. Nature, 464:504-512.
[36] Chen D, Li PW, Goldstein BA, Cai W, Thomas EL, Chen F, et al. (2013). Germline signaling mediates the synergistically prolonged longevity produced by double mutations in daf-2 and rsks-1 in C. elegans. Cell Rep, 5:1600-1610.
[37] Lithgow G, White T, Melov S, Johnson T (1995). Thermotolerance and extended life-span conferred by single-gene mutations and induced by thermal stress. Proc Natl Acad Sci U S A, 92:7540-7544.
[38] Edwards CB, Copes N, Brito AG, Canfield J, Bradshaw PC (2013). Malate and Fumarate Extend Lifespan in Caenorhabditis elegans. Plos One, 8:e58345.
[39] Postnikoff SD, Malo ME, Wong B, Harkness TA (2012). The Yeast Forkhead Transcription Factors Fkh1 and Fkh2 Regulate Lifespan and Stress Response Together with the Anaphase-Promoting Complex. PLoS Genet, 8:e1002583.
[40] Liochev SI (2013). Reactive oxygen species and the free radical theory of aging. Free Radic Biol Med, 60:1-4.
[41] Yang F, Yan G, Li Y, Han Z, Zhang L, Chen S, et al. (2016). Astragalus Polysaccharide Attenuated Iron Overload-Induced Dysfunction of Mesenchymal Stem Cells via Suppressing Mitochondrial ROS. Cell Physiol Biochem, 39:1369-1379.
[42] Ashok BT, Ali R (1999). The aging paradox: free radical theory of aging. Exp Gerontol, 34:293-303.
[43] Yuan C, Pan X, Gong Y, Xia A, Wu G, Tang J, et al. (2008). Effects of Astragalus polysaccharides (APS) on the expression of immune response genes in head kidney, gill and spleen of the common carp, Cyprinus carpio L. Int Immunopharmacol, 8:51-58.
[44] Ebersole J, Graves C, Gonzalez O, Dawson D, Morford L, Huja P, et al. (2016). Aging, inflammation, immunity and periodontal disease. Periodontol, 72:54-75.
[45] Chipman DM, Sharon N (1969). Mechanism of lysozyme action. Science, 165:454-465.
[46] Mao XQ, Yu F, Wang N, Wu Y, Zou F, Wu K, et al. (2009). Hypoglycemic effect of polysaccharide enriched extract of Astragalus membranaceus in diet induced insulin resistant C57BL/6J mice and its potential mechanism. Phytomedicine, 16:416-425.
[47] Narasimhan SD, Yen K, Tissenbaum HA (2009). Converging pathways in lifespan regulation. Curr Biol, 19:R657-R666.
[48] Yoshida H, Matsui T, Yamamoto A, Okada T, Mori K (2001). XBP1 mRNA is induced by ATF6 and spliced by IRE1 in response to ER stress to produce a highly active transcription factor. Cell, 107:881-891.
[49] Wang L, Ryoo HD, Qi Y, Jasper H (2015). PERK Limits Drosophila Lifespan by Promoting Intestinal Stem Cell Proliferation in Response to ER Stress. PLoS Genet, 11:e1005220.
[50] Naidoo N, Ferber M, Master M, Zhu Y, Pack AI (2008). Aging impairs the unfolded protein response to sleep deprivation and leads to proapoptotic signaling. J Neurosci, 28:6539-6548.
[51] Davis EJ, Lobach I, Dubal DB (2019). Female XX sex chromosomes increase survival and extend lifespan in aging mice. Aging Cell, 18:e12871.
[1] Supplementary data Download
[1] Kunlin Jin. A Microcirculatory Theory of Aging[J]. Aging and disease, 2019, 10(3): 676-683.
[2] Weidong Chen, Jinzeng Wang, Jiahao Shi, Xu Yang, Ping Yang, Ning Wang, Sai Yang, Tianpei Xie, Hua Yang, Mengjie Zhang, Haiyun Wang, Jian Fei. Longevity Effect of Liuwei Dihuang in Both Caenorhabditis Elegans and Aged Mice[J]. Aging and disease, 2019, 10(3): 578-591.
[3] Moskalev Alexey, Chernyagina Elizaveta, Kudryavtseva Anna, Shaposhnikov Mikhail. Geroprotectors: A Unified Concept and Screening Approaches[J]. Aging and disease, 2017, 8(3): 354-363.
[4] Myat Thu Thu Win,Yasuhiko Yamamoto,Seiichi Munesue,Dong Han,Shin-ichi Harada,Hiroshi Yamamoto. Validated Liquid Culture Monitoring System for Lifespan Extension of Caenorhabditis elegans through Genetic and Dietary Manipulations[J]. Aging and Disease, 2013, 4(4): 178-185.
[5] Kunlin Jin. Modern Biological Theories of Aging[J]. Aging and Disease, 2010, 1(2): 72-74.
Viewed
Full text


Abstract

Cited

  Shared   
Copyright © 2014 Aging and Disease, All Rights Reserved.
Address: Aging and Disease Editorial Office 3400 Camp Bowie Boulevard Fort Worth, TX76106 USA
Fax: (817) 735-0408 E-mail: editorial@aginganddisease.org
Powered by Beijing Magtech Co. Ltd