Please wait a minute...
 Home  About the Journal Editorial Board Aims & Scope Peer Review Policy Subscription Contact us
 
Early Edition  //  Current Issue  //  Open Special Issues  //  Archives  //  Most Read  //  Most Downloaded  //  Most Cited
Aging and disease    2020, Vol. 11 Issue (3) : 536-546     DOI: 10.14336/AD.2019.0610
Orginal Article |
Cellular and Molecular Biomarkers Indicate Premature Aging in Pseudoxanthoma Elasticum Patients
Tiemann Janina1, Wagner Thomas1, Vanakker Olivier M2, Gils Matthias van2, Cabrera José-Luis Bueno3, Ibold Bettina1, Faust Isabel1, Knabbe Cornelius1, Hendig Doris1,*
1Institut für Laboratoriums- und Transfusionsmedizin, Herz- und Diabeteszentrum Nordrhein-Westfalen, Universitätsklinik der Ruhr-Universität Bochum, Bad Oeynhausen, Germany
2Center for Medical Genetics, Ghent University Hospital, Ghent, Belgium
3Haematology Department, Hospital Universitario Puerta de Hierro-Majadahonda, Majadahonda, Spain
Download: PDF(651 KB)   HTML
Export: BibTeX | EndNote | Reference Manager | ProCite | RefWorks    
Abstract  

The molecular processes of aging are very heterogenic and not fully understood. Studies on rare progeria syndromes, which display an accelerated progression of physiological aging, can help to get a better understanding. Pseudoxanthoma elasticum (PXE) caused by mutations in the ATP-binding cassette sub-family C member 6 (ABCC6) gene shares some molecular characteristics with such premature aging diseases. Thus, this is the first study trying to broaden the knowledge of aging processes in PXE patients. In this study, we investigated aging associated biomarkers in primary human dermal fibroblasts and sera from PXE patients compared to healthy controls. Determination of serum concentrations of the aging biomarkers eotaxin-1 (CCL11), growth differentiation factor 11 (GDF11) and insulin-like growth factor 1 (IGF1) showed no significant differences between PXE patients and healthy controls. Insulin-like growth factor binding protein 3 (IGFBP3) showed a significant increase in serum concentrations of PXE patients older than 45 years compared to the appropriate control group. Tissue specific gene expression of GDF11 and IGFBP3 were significantly decreased in fibroblasts from PXE patients compared to normal human dermal fibroblasts (NHDF). IGFBP3 protein concentration in supernatants of fibroblasts from PXE patients were decreased compared to NHDF but did not reach statistical significance due to potential gender specific variations. The minor changes in concentration of circulating aging biomarkers in sera of PXE patients and the significant aberrant tissue specific expression seen for selected factors in PXE fibroblasts, suggests a link between ABCC6 deficiency and accelerated aging processes in affected peripheral tissues of PXE patients.

Keywords pseudoxanthoma elasticum      aging      CCL11      GDF11      IGF1      IGFBP     
Corresponding Authors: Hendig Doris   
About author:

These authors shared first-authorship.

Just Accepted Date: 31 July 2019   Issue Date: 13 May 2020
Service
E-mail this article
E-mail Alert
RSS
Articles by authors
Tiemann Janina
Wagner Thomas
Vanakker Olivier M
Gils Matthias van
Cabrera José-Luis Bueno
Ibold Bettina
Faust Isabel
Knabbe Cornelius
Hendig Doris
Cite this article:   
Tiemann Janina,Wagner Thomas,Vanakker Olivier M, et al. Cellular and Molecular Biomarkers Indicate Premature Aging in Pseudoxanthoma Elasticum Patients[J]. Aging and disease, 2020, 11(3): 536-546.
URL:  
http://www.aginganddisease.org/EN/10.14336/AD.2019.0610     OR
Sample IDGenderAge1Biopsy sourceABCC6 genotype2Genotype status
PXE patients
P3M amale57Neckc.3421C>T (p.R1141X)c.3883-6G>A (SSM)cht
P128M amale51Neckc.3769_3770insC (p.L1259fsX1277)c.3769_3770insC (p.L1259fsX1277)hm
P255F afemale48Armc.3421C>T (p.R1141X)c.2787+1G>T (SSM)cht
Healthy controls
M57A b
(AG13145)
male57Arm--wt
M52A b (AG11482)male52Arm--wt
F48A b
(AG14284)
female48Arm--wt
Table 1  Characterization of human dermal fibroblasts from PXE patients and healthy controls.
GeneProtein5´-3´sequenceReference1Annealing temperature (°C)Efficiency
ß-ACTIN
beta-Actin
ß-ActinCGCGAGAAGATGACCC
ATTGCCAATGGTGATGAC
NM_00110159°C2.0
GAPDH
glyceraldehyde-3-phosphate dehydrogenase
GAPDHAGGTCGGAGTCAACGGAT
TCCTGGAAGATGGTGATG
NM_00204659°C1.8

β2M beta-2-microglobulin

ß2M

TGTGCTCGCGCTACTCTCTCTT CGGATGGATGAAACCCAGACA

NM_004048

59°C

2.0

GDF11 growth differentiation factor 11

GDF11

AGGCCATTGGCAGAGCATCGAC GTCCCAGCCGAAAGCCTCAAAG

NM_005811.3

63°C

2.0

IGFBP3 insulin-like growth factor binding protein 3

IGFBP3

GCGCCAGGAAATGCTAGTGA GGGAATGTGTACACCCCTGG

NM_001013398.1

63°C

1.8
Table 2  Primer sequences used for quantitative real-time PCR.
Figure 1.  CCL11 protein concentration in sera from PXE patients (grey) and healthy controls (white). Data are shown as Box-Plot with median, 25th and 75th percentile and Tukey whiskers (± 1.5 times interquartile range). Control vs. PXE: ns p>0.05. Cohorts <45 years (n=23) vs. cohorts >45 years (n=22): ##/++ p≤0.01.
Figure 2.  Systemic concentration and local mRNA expression of GDF11. (A) GDF11 protein concentration in sera from PXE patients (grey) and healthy controls (white). Data are shown as Box-Plot with median, 25th and 75th percentile and Tukey whiskers (± 1.5 times interquartile range). (B) Relative GDF11 mRNA-expression of PXE fibroblasts (grey) and NHDF (white). Data are shown as mean ± SEM. Control vs. PXE: *** p ≤0.001. Cohorts <45 years (n=23) vs. cohorts >45 years (n=22): ns p>0.05.
Figure 3.  Systemic IGF1 and IGFBP3 protein concentration in sera from PXE patients (grey) and healthy controls (white). (A) IGF1 serum protein concentrations of PXE patients (grey) and healthy controls (white) (B) IGFBP3 serum protein concentrations of PXE patients (grey) and healthy controls (white) (C) molar IGF1/IGFBP3 ratio of serum protein concentrations of PXE patients (grey) and healthy controls (white). Data are shown as Box-Plot with median, 25th and 75th percentile and Tukey whiskers (± 1.5 times interquartile range). Control vs. PXE: * p≤0.05; ns p>0.05. Cohorts <45 years (n=23) vs. cohorts >45 years (n=22): ns p>0.05.
Figure 4.  Local IGFBP3 mRNA expression and protein concentration. (A) Relative IGFBP3 mRNA expression of PXE fibroblasts (grey) and NHDF (white). (B) IGFBP3 protein concentration in supernatant of PXE fibroblasts (grey) and NHDF (white). Data are shown as mean ± SEM. Control vs. PXE: * p≤0.05; ns p>0.05.
Figure 5.  Male and female specific IGFBP3 mRNA expression and protein concentration. (A) Relative IGFBP3 mRNA expression of female PXE fibroblasts (grey) and NHDF (white). (B) IGFBP3 protein concentration in supernatant of female PXE fibroblasts (grey) and NHDF (white). (C) Relative IGFBP3 mRNA expression of male PXE fibroblasts (grey) and NHDF (white). (D) IGFBP3 protein concentration in supernatant of male PXE fibroblasts (grey) and NHDF (white). Data are shown as mean ± SEM. Control vs. PXE: ** p≤0.01; ns p>0.05.
[1] López-Otín C, Blasco MA, Partridge L, Serrano M, Kroemer G (2013). The hallmarks of aging. Cell, 153:1194-1217.
[2] Varela I, Cadinanos J, Pendas AM, Gutierrez-Fernandez A, Folgueras AR, Sanchez LM, et al. (2005). Accelerated ageing in mice deficient in Zmpste24 protease is linked to p53 signalling activation. Nature, 437:564-568.
[3] Varela I, Pereira S, Ugalde AP, Navarro CL, Suarez MF, Cau P, et al. (2008). Combined treatment with statins and aminobisphosphonates extends longevity in a mouse model of human premature aging. Nat Med, 14:767-772.
[4] Butala P, Szpalski C, Soares M, Davidson EH, Knobel D, Warren SM (2012). Zmpste24-/- mouse model for senescent wound healing research. Plast Reconstr Surg, 130:788e-798e.
[5] Legrand A, Cornez L, Samkari W, Mazzella JM, Venisse A, Boccio V, et al. (2017). Mutation spectrum in the ABCC6 gene and genotype-phenotype correlations in a French cohort with pseudoxanthoma elasticum. Genet Med, 19:909-917.
[6] Ronchetti I, Boraldi F, Annovi G, Cianciulli P, Quaglino D (2013). Fibroblast involvement in soft connective tissue calcification. Front Genet, 4:22.
[7] Germain DP (2017). Pseudoxanthoma elasticum. Orphanet J Rare Dis, 12:85.
[8] Gliem M, Zaeytijd JD, Finger RP, Holz FG, Leroy BP, Charbel Issa P (2013). An update on the ocular phenotype in patients with pseudoxanthoma elasticum. Front Genet, 4:14.
[9] Jansen RS, Kucukosmanoglu A, de Haas M, Sapthu S, Otero JA, Hegman IE, et al. (2013). ABCC6 prevents ectopic mineralization seen in pseudoxanthoma elasticum by inducing cellular nucleotide release. Proc Natl Acad Sci U S A, 110:20206-20211.
[10] Boraldi F, Annovi G, Bartolomeo A, Quaglino D (2014). Fibroblasts from patients affected by Pseudoxanthoma elasticum exhibit an altered PPi metabolism and are more responsive to pro-calcifying stimuli. J Dermatol Sci, 74:72-80.
[11] Jansen RS, Duijst S, Mahakena S, Sommer D, Szeri F, Varadi A, et al. (2014). ABCC6-mediated ATP secretion by the liver is the main source of the mineralization inhibitor inorganic pyrophosphate in the systemic circulation-brief report. Arterioscler Thromb Vasc Biol, 34:1985-1989.
[12] Dabisch-Ruthe M, Kuzaj P, Götting C, Knabbe C, Hendig D (2014). Pyrophosphates as a major inhibitor of matrix calcification in Pseudoxanthoma elasticum. J Dermatol Sci, 75:109-120.
[13] Villa-Bellosta R, Rivera-Torres J, Osorio FG, Acin-Perez R, Enriquez JA, López-Otín C, et al. (2013). Defective extracellular pyrophosphate metabolism promotes vascular calcification in a mouse model of Hutchinson-Gilford progeria syndrome that is ameliorated on pyrophosphate treatment. Circulation, 127:2442-2451.
[14] Guo H, Li Q, Chou DW, Uitto J (2013). Atorvastatin counteracts aberrant soft tissue mineralization in a mouse model of pseudoxanthoma elasticum (Abcc6(-)/(-)). J Mol Med (Berl), 91:1177-1184.
[15] Luft FC (2013). Pseudoxanthoma elasticum and statin prophylaxis. J Mol Med (Berl), 91:1129-1130.
[16] Li Q, Sundberg JP, Levine MA, Terry SF, Uitto J (2015). The effects of bisphosphonates on ectopic soft tissue mineralization caused by mutations in the ABCC6 gene. Cell Cycle, 14:1082-1089.
[17] Martin LJ, Lau E, Singh H, Vergnes L, Tarling EJ, Mehrabian M, et al. (2012). ABCC6 localizes to the mitochondria-associated membrane. Circ Res, 111:516-520.
[18] Diekmann U, Zarbock R, Hendig D, Szliska C, Kleesiek K, Götting C (2009). Elevated circulating levels of matrix metalloproteinases MMP-2 and MMP-9 in pseudoxanthoma elasticum patients. J Mol Med (Berl), 87:965-970.
[19] Swindell WR, Masternak MM, Kopchick JJ, Conover CA, Bartke A, Miller RA (2009). Endocrine regulation of heat shock protein mRNA levels in long-lived dwarf mice. Mech Ageing Dev, 130:393-400.
[20] Min JN, Whaley RA, Sharpless NE, Lockyer P, Portbury AL, Patterson C (2008). CHIP deficiency decreases longevity, with accelerated aging phenotypes accompanied by altered protein quality control. Mol Cell Biol, 28:4018-4025.
[21] Trifunovic A, Wredenberg A, Falkenberg M, Spelbrink JN, Rovio AT, Bruder CE, et al. (2004). Premature ageing in mice expressing defective mitochondrial DNA polymerase. Nature, 429:417-423.
[22] Katsimpardi L, Litterman NK, Schein PA, Miller CM, Loffredo FS, Wojtkiewicz GR, et al. (2014). Vascular and neurogenic rejuvenation of the aging mouse brain by young systemic factors. Science, 344:630-634.
[23] Conboy IM, Conboy MJ, Wagers AJ, Girma ER, Weissman IL, Rando TA (2005). Rejuvenation of aged progenitor cells by exposure to a young systemic environment. Nature, 433:760-764.
[24] Loffredo FS, Steinhauser ML, Jay SM, Gannon J, Pancoast JR, Yalamanchi P, et al. (2013). Growth differentiation factor 11 is a circulating factor that reverses age-related cardiac hypertrophy. Cell, 153:828-839.
[25] Jiang Q, Oldenburg R, Otsuru S, Grand-Pierre AE, Horwitz EM, Uitto J (2010). Parabiotic heterogenetic pairing of Abcc6-/-/Rag1-/- mice and their wild-type counterparts halts ectopic mineralization in a murine model of pseudoxanthoma elasticum. Am J Pathol, 176:1855-1862.
[26] Le Saux O, Bunda S, VanWart CM, Douet V, Got L, Martin L, et al. (2006). Serum factors from pseudoxanthoma elasticum patients alter elastic fiber formation in vitro. J Invest Dermatol, 126:1497-1505.
[27] Sinha M, Jang YC, Oh J, Khong D, Wu EY, Manohar R, et al. (2014). Restoring Systemic GDF11 Levels Reverses Age-Related Dysfunction in Mouse Skeletal Muscle. Science, 344:649-652.
[28] Yoon IK, Kim HK, Kim YK, Song IH, Kim W, Kim S, et al. (2004). Exploration of replicative senescence-associated genes in human dermal fibroblasts by cDNA microarray technology. Exp Gerontol, 39:1369-1378.
[29] Villeda SA, Luo J, Mosher KI, Zou B, Britschgi M, Bieri G, et al. (2011). The ageing systemic milieu negatively regulates neurogenesis and cognitive function. Nature, 477:90-94.
[30] Marino G, Ugalde AP, Fernandez AF, Osorio FG, Fueyo A, Freije JM, et al. (2010). Insulin-like growth factor 1 treatment extends longevity in a mouse model of human premature aging by restoring somatotroph axis function. Proc Natl Acad Sci U S A, 107:16268-16273.
[31] Plomp AS, Toonstra J, Bergen AA, van Dijk MR, de Jong PT (2010). Proposal for updating the pseudoxanthoma elasticum classification system and a review of the clinical findings. Am J Med Genet A, 152A:1049-1058.
[32] Hendig D, Langmann T, Kocken S, Zarbock R, Szliska C, Schmitz G, et al. (2008). Gene expression profiling of ABC transporters in dermal fibroblasts of pseudoxanthoma elasticum patients identifies new candidates involved in PXE pathogenesis. Lab Invest, 88:1303-1315.
[33] Bueno JL, Ynigo M, de Miguel C, Gonzalo-Daganzo RM, Richart A, Vilches C, et al. (2016). Growth differentiation factor 11 (GDF11) - a promising anti-ageing factor - is highly concentrated in platelets. Vox Sang, 111:434-436.
[34] Matthews AN, Friend DS, Zimmermann N, Sarafi MN, Luster AD, Pearlman E, et al. (1998). Eotaxin is required for the baseline level of tissue eosinophils. Proc Natl Acad Sci U S A, 95:6273-6278.
[35] Haley KJ, Lilly CM, Yang JH, Feng Y, Kennedy SP, Turi TG, et al. (2000). Overexpression of eotaxin and the CCR3 receptor in human atherosclerosis: using genomic technology to identify a potential novel pathway of vascular inflammation. Circulation, 102:2185-2189.
[36] Hoefer J, Luger M, Dal-Pont C, Culig Z, Schennach H, Jochberger S (2017). The "Aging Factor" Eotaxin-1 (CCL11) Is Detectable in Transfusion Blood Products and Increases with the Donor's Age. Front Aging Neurosci, 9:402.
[37] Mo FM, Proia AD, Johnson WH, Cyr D, Lashkari K (2010). Interferon gamma-inducible protein-10 (IP-10) and eotaxin as biomarkers in age-related macular degeneration. Invest Ophthalmol Vis Sci, 51:4226-4236.
[38] Georgalas I, Tservakis I, Papaconstaninou D, Kardara M, Koutsandrea C, Ladas I (2011). Pseudoxanthoma elasticum, ocular manifestations, complications and treatment. Clin Exp Optom, 94:169-180.
[39] Myung JS, Bhatnagar P, Spaide RF, Klancnik JM Jr., Cooney MJ, Yannuzzi LA, et al. (2010). Long-term outcomes of intravitreal antivascular endothelial growth factor therapy for the management of choroidal neovascularization in pseudoxanthoma elasticum. Retina, 30:748-755.
[40] Ellabban AA, Hangai M, Yamashiro K, Nakagawa S, Tsujikawa A, Yoshimura N (2012). Tomographic fundus features in pseudoxanthoma elasticum: comparison with neovascular age-related macular degeneration in Japanese patients. Eye (Lond), 26:1086-1094.
[41] McPherron AC, Lawler AM, Lee SJ (1999). Regulation of anterior/posterior patterning of the axial skeleton by growth/differentiation factor 11. Nat Genet, 22:260-264.
[42] Egerman MA, Cadena SM, Gilbert JA, Meyer A, Nelson HN, Swalley SE, et al. (2015). GDF11 Increases with Age and Inhibits Skeletal Muscle Regeneration. Cell Metab, 22:164-174.
[43] Smith SC, Zhang X, Gross P, Starosta T, Mohsin S, Franti M, et al. (2015). GDF11 does not rescue aging-related pathological hypertrophy. Circ Res, 117:926-932.
[44] Poggioli T, Vujic A, Yang P, Macias-Trevino C, Uygur A, Loffredo FS, et al. (2016). Circulating Growth Differentiation Factor 11/8 Levels Decline With Age. Circ Res, 118:29-37.
[45] Olson KA, Beatty AL, Heidecker B, Regan MC, Brody EN, Foreman T, et al. (2015). Association of growth differentiation factor 11/8, putative anti-ageing factor, with cardiovascular outcomes and overall mortality in humans: analysis of the Heart and Soul and HUNT3 cohorts. Eur Heart J, 36:3426-3434.
[46] Puche JE, Castilla-Cortazar I (2012). Human conditions of insulin-like growth factor-I (IGF-I) deficiency. J Transl Med, 10:224.
[47] O'Connor KG, Tobin JD, Harman SM, Plato CC, Roy TA, Sherman SS, et al. (1998). Serum levels of insulin-like growth factor-I are related to age and not to body composition in healthy women and men. J Gerontol A Biol Sci Med Sci, 53:M176-182.
[48] Sjogren K, Liu JL, Blad K, Skrtic S, Vidal O, Wallenius V, et al. (1999). Liver-derived insulin-like growth factor I (IGF-I) is the principal source of IGF-I in blood but is not required for postnatal body growth in mice. Proc Natl Acad Sci U S A, 96:7088-7092.
[49] Firth SM, Baxter RC (2002). Cellular actions of the insulin-like growth factor binding proteins. Endocr Rev, 23:824-854.
[50] Kim KS, Kim MS, Seu YB, Chung HY, Kim JH, Kim JR (2007). Regulation of replicative senescence by insulin-like growth factor-binding protein 3 in human umbilical vein endothelial cells. Aging Cell, 6:535-545.
[51] Oliver WT, Rosenberger J, Lopez R, Gomez A, Cummings KK, Fiorotto ML (2005). The local expression and abundance of insulin-like growth factor (IGF) binding proteins in skeletal muscle are regulated by age and gender but not local IGF-I in vivo. Endocrinology, 146:5455-5462.
[52] Lofqvist C, Chen J, Connor KM, Smith AC, Aderman CM, Liu N, et al. (2007). IGFBP3 suppresses retinopathy through suppression of oxygen-induced vessel loss and promotion of vascular regrowth. Proc Natl Acad Sci U S A, 104:10589-10594.
[53] Kuzaj P, Kuhn J, Dabisch-Ruthe M, Faust I, Gotting C, Knabbe C, et al. (2014). ABCC6- a new player in cellular cholesterol and lipoprotein metabolism? Lipids Health Dis, 13:118.
[1] Ban Tae H, Kim Eun N, Kim Min Y, Lim Ji H, Lee Jong H, Kim Hyung D, Yoon Hye E, Park Cheol W, Choi Bum S. Renoprotective Effect of a Dipeptidyl Peptidase-4 Inhibitor on Aging Mice[J]. Aging and disease, 2020, 11(3): 588-602.
[2] Song Hyun-Doo, Kim Sang Nam, Saha Abhirup, Ahn Sang-Yeop, Akindehin Seun, Son Yeonho, Cho Yoon Keun, Kim MinSu, Park Ji-Hyun, Jung Young-Suk, Lee Yun-Hee. Aging-Induced Brain-Derived Neurotrophic Factor in Adipocyte Progenitors Contributes to Adipose Tissue Dysfunction[J]. Aging and disease, 2020, 11(3): 575-587.
[3] Fulzele Sadanand, Sahay Bikash, Yusufu Ibrahim, Lee Tae Jin, Sharma Ashok, Kolhe Ravindra, Isales Carlos M. COVID-19 Virulence in Aged Patients Might Be Impacted by the Host Cellular MicroRNAs Abundance/Profile[J]. Aging and disease, 2020, 11(3): 509-522.
[4] Sunil S Adav, Siu Kwan Sze. Hypoxia-Induced Degenerative Protein Modifications Associated with Aging and Age-Associated Disorders[J]. Aging and disease, 2020, 11(2): 341-364.
[5] Ming Dong, Ziyi Yang, Hongcheng Fang, Jiaqing Xiang, Cong Xu, Yanqing Zhou, Qianying Wu, Jie Liu. Aging Attenuates Cardiac Contractility and Affects Therapeutic Consequences for Myocardial Infarction[J]. Aging and disease, 2020, 11(2): 365-376.
[6] Piotr Gronek, Dariusz Wielinski, Piotr Cyganski, Andrzej Rynkiewicz, Adam Zając, Adam Maszczyk, Joanna Gronek, Robert Podstawski, Wojciech Czarny, Stefan Balko, Cain CT. Clark, Roman Celka. A Review of Exercise as Medicine in Cardiovascular Disease: Pathology and Mechanism[J]. Aging and disease, 2020, 11(2): 327-340.
[7] Wanqing Sun, Yishi Wang, Yang Zheng, Nanhu Quan. The Emerging Role of Sestrin2 in Cell Metabolism, and Cardiovascular and Age-Related Diseases[J]. Aging and disease, 2020, 11(1): 154-163.
[8] Yu-Qing Ni, Xiao Lin, Jun-Kun Zhan, You-Shuo Liu. Roles and Functions of Exosomal Non-coding RNAs in Vascular Aging[J]. Aging and disease, 2020, 11(1): 164-178.
[9] Xiaojie Zhao, Yan Fan, Philip H. Vann, Jessica M. Wong, Nathalie Sumien, Johnny J. He. Long-term HIV-1 Tat Expression in the Brain Led to Neurobehavioral, Pathological, and Epigenetic Changes Reminiscent of Accelerated Aging[J]. Aging and disease, 2020, 11(1): 93-107.
[10] Shijin Xia, Changxi Zhou, Bill Kalionis, Xiaoping Shuang, Haiyan Ge, Wen Gao. Combined Antioxidant, Anti-inflammaging and Mesenchymal Stem Cell Treatment: A Possible Therapeutic Direction in Elderly Patients with Chronic Obstructive Pulmonary Disease[J]. Aging and disease, 2020, 11(1): 129-140.
[11] Dae Hyun Kim, June Whoun Park, Hyoung Oh Jeong, Bonggi Lee, Ki Wung Chung, Yujeong Lee, Hee Jin Jung, Min Kyung Hyun, A Kyoung Lee, Byeong Moo Kim, Byung Pal Yu, Hae Young Chung. Novel Role of Lck in Leptin-Induced Inflammation and Implications for Renal Aging[J]. Aging and disease, 2019, 10(6): 1174-1186.
[12] Piotr Gronek, Stefan Balko, Joanna Gronek, Adam Zajac, Adam Maszczyk, Roman Celka, Agnieszka Doberska, Wojciech Czarny, Robert Podstawski, Cain C. T Clark, Fang Yu. Physical Activity and Alzheimer’s Disease: A Narrative Review[J]. Aging and disease, 2019, 10(6): 1282-1292.
[13] Meili Wang, Xiaochen Yin, Suli Zhang, Chenfeng Mao, Ning Cao, Xiaochun Yang, Jingwei Bian, Weiwei Hao, Qian Fan, Huirong Liu. Autoantibodies against AT1 Receptor Contribute to Vascular Aging and Endothelial Cell Senescence[J]. Aging and disease, 2019, 10(5): 1012-1025.
[14] Yingnan Xue, Zhenhua Zhang, Caiyun Wen, Huiru Liu, Suyuan Wang, Jiance Li, Qichuan Zhuge, Weijian Chen, Qiong Ye. Characterization of Alzheimer’s Disease Using Ultra-high b-values Apparent Diffusion Coefficient and Diffusion Kurtosis Imaging[J]. Aging and disease, 2019, 10(5): 1026-1036.
[15] Aibo Wang, Rui Wang, Dehua Cui, Xinrui Huang, Lan Yuan, Huipo Liu, Yu Fu, Lei Liang, Wei Wang, Qingyuan He, Chunyan Shi, Xiangping Guan, Ze Teng, Guomei Zhao, Yuanyuan Li, Yajuan Gao, Hongbin Han. The Drainage of Interstitial Fluid in the Deep Brain is Controlled by the Integrity of Myelination[J]. Aging and disease, 2019, 10(5): 937-948.
Viewed
Full text


Abstract

Cited

  Shared   
Copyright © 2014 Aging and Disease, All Rights Reserved.
Address: Aging and Disease Editorial Office 3400 Camp Bowie Boulevard Fort Worth, TX76106 USA
Fax: (817) 735-0408 E-mail: editorial@aginganddisease.org
Powered by Beijing Magtech Co. Ltd