Please wait a minute...
 Home  About the Journal Editorial Board Aims & Scope Peer Review Policy Subscription Contact us
 
Early Edition  //  Current Issue  //  Open Special Issues  //  Archives  //  Most Read  //  Most Downloaded  //  Most Cited
Aging and disease
Orginal Article |
Cellular and Molecular Biomarkers Indicate Premature Aging in Pseudoxanthoma Elasticum Patients
Janina Tiemann1, Thomas Wagner1, Olivier M. Vanakker2, Matthias van Gils2, José-Luis Bueno Cabrera3, Bettina Ibold1, Isabel Faust1, Cornelius Knabbe1, Doris Hendig1,*
1Institut für Laboratoriums- und Transfusionsmedizin, Herz- und Diabeteszentrum Nordrhein-Westfalen, Universitätsklinik der Ruhr-Universität Bochum, Bad Oeynhausen, Germany
2Center for Medical Genetics, Ghent University Hospital, Ghent, Belgium
3Haematology Department, Hospital Universitario Puerta de Hierro-Majadahonda, Majadahonda, Spain
Download: PDF(664 KB)   HTML
Export: BibTeX | EndNote | Reference Manager | ProCite | RefWorks    
Abstract  

The molecular processes of aging are very heterogenic and not fully understood. Studies on rare progeria syndromes, which display an accelerated progression of physiological aging, can help to get a better understanding. Pseudoxanthoma elasticum (PXE) caused by mutations in the ATP-binding cassette sub-family C member 6 (ABCC6) gene shares some molecular characteristics with such premature aging diseases. Thus, this is the first study trying to broaden the knowledge of aging processes in PXE patients. In this study, we investigated aging associated biomarkers in primary human dermal fibroblasts and sera from PXE patients compared to healthy controls. Determination of serum concentrations of the aging biomarkers eotaxin-1 (CCL11), growth differentiation factor 11 (GDF11) and insulin-like growth factor 1 (IGF1) showed no significant differences between PXE patients and healthy controls. Insulin-like growth factor binding protein 3 (IGFBP3) showed a significant increase in serum concentrations of PXE patients older than 45 years compared to the appropriate control group. Tissue specific gene expression of GDF11 and IGFBP3 were significantly decreased in fibroblasts from PXE patients compared to normal human dermal fibroblasts (NHDF). IGFBP3 protein concentration in supernatants of fibroblasts from PXE patients were decreased compared to NHDF but did not reach statistical significance due to potential gender specific variations. The minor changes in concentration of circulating aging biomarkers in sera of PXE patients and the significant aberrant tissue specific expression seen for selected factors in PXE fibroblasts, suggests a link between ABCC6 deficiency and accelerated aging processes in affected peripheral tissues of PXE patients.

Keywords pseudoxanthoma elasticum      aging      CCL11      GDF11      IGF1      IGFBP     
Corresponding Authors: Doris Hendig   
About author:

These authors contributed equally to this study.

Just Accepted Date: 31 July 2019  
Service
E-mail this article
E-mail Alert
RSS
Articles by authors
Janina Tiemann
Thomas Wagner
Olivier M. Vanakker
Matthias van Gils
José-Luis Bueno Cabrera
Bettina Ibold
Isabel Faust
Cornelius Knabbe
Doris Hendig
Cite this article:   
Janina Tiemann,Thomas Wagner,Olivier M. Vanakker, et al. Cellular and Molecular Biomarkers Indicate Premature Aging in Pseudoxanthoma Elasticum Patients[J]. Aging and disease, 10.14336/AD.2019.0610
URL:  
http://www.aginganddisease.org/EN/10.14336/AD.2019.0610     OR     http://www.aginganddisease.org/EN/Y/V/I/0
Sample IDGenderAge1Biopsy sourceABCC6 genotype2Genotype status
PXE patients
P3M amale57Neckc.3421C>T (p.R1141X)c.3883-6G>A (SSM)cht
P128M amale51Neckc.3769_3770insC (p.L1259fsX1277)c.3769_3770insC (p.L1259fsX1277)hm
P255F afemale48Armc.3421C>T (p.R1141X)c.2787+1G>T (SSM)cht
Healthy controls
M57A b
(AG13145)
male57Arm--wt
M52A b (AG11482)male52Arm--wt
F48A b
(AG14284)
female48Arm--wt
Table 1  Characterization of human dermal fibroblasts from PXE patients and healthy controls.
GeneProtein5´-3´sequenceReference1Annealing temperature (°C)Efficiency
ß-ACTIN
beta-Actin
ß-ActinCGCGAGAAGATGACCC
ATTGCCAATGGTGATGAC
NM_00110159°C2.0
GAPDH
glyceraldehyde-3-phosphate dehydrogenase
GAPDHAGGTCGGAGTCAACGGAT
TCCTGGAAGATGGTGATG
NM_00204659°C1.8

β2M beta-2-microglobulin

ß2M

TGTGCTCGCGCTACTCTCTCTT CGGATGGATGAAACCCAGACA

NM_004048

59°C

2.0

GDF11 growth differentiation factor 11

GDF11

AGGCCATTGGCAGAGCATCGAC GTCCCAGCCGAAAGCCTCAAAG

NM_005811.3

63°C

2.0

IGFBP3 insulin-like growth factor binding protein 3

IGFBP3

GCGCCAGGAAATGCTAGTGA GGGAATGTGTACACCCCTGG

NM_001013398.1

63°C

1.8
Table 2  Primer sequences used for quantitative real-time PCR.
Figure 1.  CCL11 protein concentration in sera from PXE patients (grey) and healthy controls (white). Data are shown as Box-Plot with median, 25th and 75th percentile and Tukey whiskers (± 1.5 times interquartile range). Control/PXE: ns p>0.05. Cohorts <45 years (n=23) vs. cohorts >45 years (n=22): ##/++ p≤0.01.
Figure 2.  Systemic concentration and local mRNA expression of GDF11. (A) GDF11 protein concentration in sera from PXE patients (grey) and healthy controls (white). Data are shown as Box-Plot with median, 25th and 75th percentile and Tukey whiskers (± 1.5 times interquartile range). (B) Relative GDF11 mRNA-expression of PXE fibroblasts (grey) and NHDF (white). Data are shown as mean ± SEM. Control/PXE: *** p ≤0.001. Cohorts <45 years (n=23) vs. cohorts >45 years (n=22): ns p>0.05.
Figure 3.  Systemic IGF1 and IGFBP3 protein concentration in sera from PXE patients (grey) and healthy controls (white). (A) IGF1 serum protein concentrations of PXE patients (grey) and healthy controls (white) (B) IGFBP3 serum protein concentrations of PXE patients (grey) and healthy controls (white) (C) molar IGF1/IGFBP3 ratio of serum protein concentrations of PXE patients (grey) and healthy controls (white). Data are shown as Box-Plot with median, 25th and 75th percentile and Tukey whiskers (± 1.5 times interquartile range). Control/PXE: * p≤0.05; ns p>0.05. Cohorts <45 years (n=23) vs. cohorts >45 years (n=22): ns p>0.05.
Figure 4.  Local IGFBP3 mRNA expression and protein concentration. (A) Relative IGFBP3 mRNA expression of PXE fibroblasts (grey) and NHDF (white). (B) IGFBP3 protein concentration in supernatant of PXE fibroblasts (grey) and NHDF (white). Data are shown as mean ± SEM. Control/PXE: * p≤0.05; ns p>0.05.
Figure 5.  Male and female specific IGFBP3 mRNA expression and protein concentration. (A) Relative IGFBP3 mRNA expression of female PXE fibroblasts (grey) and NHDF (white). (B) IGFBP3 protein concentration in supernatant of female PXE fibroblasts (grey) and NHDF (white). (C) Relative IGFBP3 mRNA expression of male PXE fibroblasts (grey) and NHDF (white). (D) IGFBP3 protein concentration in supernatant of male PXE fibroblasts (grey) and NHDF (white). Data are shown as mean ± SEM. Control/PXE: ** p≤0.01; ns p>0.05.
[1] López-Otín C, Blasco MA, Partridge L, Serrano M, Kroemer G (2013). The hallmarks of aging. Cell, 153:1194-1217.
[2] Varela I, Cadinanos J, Pendas AM, Gutierrez-Fernandez A, Folgueras AR, Sanchez LM, et al. (2005). Accelerated ageing in mice deficient in Zmpste24 protease is linked to p53 signalling activation. Nature, 437:564-568.
[3] Varela I, Pereira S, Ugalde AP, Navarro CL, Suarez MF, Cau P, et al. (2008). Combined treatment with statins and aminobisphosphonates extends longevity in a mouse model of human premature aging. Nat Med, 14:767-772.
[4] Butala P, Szpalski C, Soares M, Davidson EH, Knobel D, Warren SM (2012). Zmpste24-/- mouse model for senescent wound healing research. Plast Reconstr Surg, 130:788e-798e.
[5] Legrand A, Cornez L, Samkari W, Mazzella JM, Venisse A, Boccio V, et al. (2017). Mutation spectrum in the ABCC6 gene and genotype-phenotype correlations in a French cohort with pseudoxanthoma elasticum. Genet Med, 19:909-917.
[6] Ronchetti I, Boraldi F, Annovi G, Cianciulli P, Quaglino D (2013). Fibroblast involvement in soft connective tissue calcification. Front Genet, 4:22.
[7] Germain DP (2017). Pseudoxanthoma elasticum. Orphanet J Rare Dis, 12:85.
[8] Gliem M, Zaeytijd JD, Finger RP, Holz FG, Leroy BP, Charbel Issa P (2013). An update on the ocular phenotype in patients with pseudoxanthoma elasticum. Front Genet, 4:14.
[9] Jansen RS, Kucukosmanoglu A, de Haas M, Sapthu S, Otero JA, Hegman IE, et al. (2013). ABCC6 prevents ectopic mineralization seen in pseudoxanthoma elasticum by inducing cellular nucleotide release. Proc Natl Acad Sci U S A, 110:20206-20211.
[10] Boraldi F, Annovi G, Bartolomeo A, Quaglino D (2014). Fibroblasts from patients affected by Pseudoxanthoma elasticum exhibit an altered PPi metabolism and are more responsive to pro-calcifying stimuli. J Dermatol Sci, 74:72-80.
[11] Jansen RS, Duijst S, Mahakena S, Sommer D, Szeri F, Varadi A, et al. (2014). ABCC6-mediated ATP secretion by the liver is the main source of the mineralization inhibitor inorganic pyrophosphate in the systemic circulation-brief report. Arterioscler Thromb Vasc Biol, 34:1985-1989.
[12] Dabisch-Ruthe M, Kuzaj P, Götting C, Knabbe C, Hendig D (2014). Pyrophosphates as a major inhibitor of matrix calcification in Pseudoxanthoma elasticum. J Dermatol Sci, 75:109-120.
[13] Villa-Bellosta R, Rivera-Torres J, Osorio FG, Acin-Perez R, Enriquez JA, López-Otín C, et al. (2013). Defective extracellular pyrophosphate metabolism promotes vascular calcification in a mouse model of Hutchinson-Gilford progeria syndrome that is ameliorated on pyrophosphate treatment. Circulation, 127:2442-2451.
[14] Guo H, Li Q, Chou DW, Uitto J (2013). Atorvastatin counteracts aberrant soft tissue mineralization in a mouse model of pseudoxanthoma elasticum (Abcc6(-)/(-)). J Mol Med (Berl), 91:1177-1184.
[15] Luft FC (2013). Pseudoxanthoma elasticum and statin prophylaxis. J Mol Med (Berl), 91:1129-1130.
[16] Li Q, Sundberg JP, Levine MA, Terry SF, Uitto J (2015). The effects of bisphosphonates on ectopic soft tissue mineralization caused by mutations in the ABCC6 gene. Cell Cycle, 14:1082-1089.
[17] Martin LJ, Lau E, Singh H, Vergnes L, Tarling EJ, Mehrabian M, et al. (2012). ABCC6 localizes to the mitochondria-associated membrane. Circ Res, 111:516-520.
[18] Diekmann U, Zarbock R, Hendig D, Szliska C, Kleesiek K, Götting C (2009). Elevated circulating levels of matrix metalloproteinases MMP-2 and MMP-9 in pseudoxanthoma elasticum patients. J Mol Med (Berl), 87:965-970.
[19] Swindell WR, Masternak MM, Kopchick JJ, Conover CA, Bartke A, Miller RA (2009). Endocrine regulation of heat shock protein mRNA levels in long-lived dwarf mice. Mech Ageing Dev, 130:393-400.
[20] Min JN, Whaley RA, Sharpless NE, Lockyer P, Portbury AL, Patterson C (2008). CHIP deficiency decreases longevity, with accelerated aging phenotypes accompanied by altered protein quality control. Mol Cell Biol, 28:4018-4025.
[21] Trifunovic A, Wredenberg A, Falkenberg M, Spelbrink JN, Rovio AT, Bruder CE, et al. (2004). Premature ageing in mice expressing defective mitochondrial DNA polymerase. Nature, 429:417-423.
[22] Katsimpardi L, Litterman NK, Schein PA, Miller CM, Loffredo FS, Wojtkiewicz GR, et al. (2014). Vascular and neurogenic rejuvenation of the aging mouse brain by young systemic factors. Science, 344:630-634.
[23] Conboy IM, Conboy MJ, Wagers AJ, Girma ER, Weissman IL, Rando TA (2005). Rejuvenation of aged progenitor cells by exposure to a young systemic environment. Nature, 433:760-764.
[24] Loffredo FS, Steinhauser ML, Jay SM, Gannon J, Pancoast JR, Yalamanchi P, et al. (2013). Growth differentiation factor 11 is a circulating factor that reverses age-related cardiac hypertrophy. Cell, 153:828-839.
[25] Jiang Q, Oldenburg R, Otsuru S, Grand-Pierre AE, Horwitz EM, Uitto J (2010). Parabiotic heterogenetic pairing of Abcc6-/-/Rag1-/- mice and their wild-type counterparts halts ectopic mineralization in a murine model of pseudoxanthoma elasticum. Am J Pathol, 176:1855-1862.
[26] Le Saux O, Bunda S, VanWart CM, Douet V, Got L, Martin L, et al. (2006). Serum factors from pseudoxanthoma elasticum patients alter elastic fiber formation in vitro. J Invest Dermatol, 126:1497-1505.
[27] Sinha M, Jang YC, Oh J, Khong D, Wu EY, Manohar R, et al. (2014). Restoring Systemic GDF11 Levels Reverses Age-Related Dysfunction in Mouse Skeletal Muscle. Science, 344:649-652.
[28] Yoon IK, Kim HK, Kim YK, Song IH, Kim W, Kim S, et al. (2004). Exploration of replicative senescence-associated genes in human dermal fibroblasts by cDNA microarray technology. Exp Gerontol, 39:1369-1378.
[29] Villeda SA, Luo J, Mosher KI, Zou B, Britschgi M, Bieri G, et al. (2011). The ageing systemic milieu negatively regulates neurogenesis and cognitive function. Nature, 477:90-94.
[30] Marino G, Ugalde AP, Fernandez AF, Osorio FG, Fueyo A, Freije JM, et al. (2010). Insulin-like growth factor 1 treatment extends longevity in a mouse model of human premature aging by restoring somatotroph axis function. Proc Natl Acad Sci U S A, 107:16268-16273.
[31] Plomp AS, Toonstra J, Bergen AA, van Dijk MR, de Jong PT (2010). Proposal for updating the pseudoxanthoma elasticum classification system and a review of the clinical findings. Am J Med Genet A, 152A:1049-1058.
[32] Hendig D, Langmann T, Kocken S, Zarbock R, Szliska C, Schmitz G, et al. (2008). Gene expression profiling of ABC transporters in dermal fibroblasts of pseudoxanthoma elasticum patients identifies new candidates involved in PXE pathogenesis. Lab Invest, 88:1303-1315.
[33] Bueno JL, Ynigo M, de Miguel C, Gonzalo-Daganzo RM, Richart A, Vilches C, et al. (2016). Growth differentiation factor 11 (GDF11) - a promising anti-ageing factor - is highly concentrated in platelets. Vox Sang, 111:434-436.
[34] Matthews AN, Friend DS, Zimmermann N, Sarafi MN, Luster AD, Pearlman E, et al. (1998). Eotaxin is required for the baseline level of tissue eosinophils. Proc Natl Acad Sci U S A, 95:6273-6278.
[35] Haley KJ, Lilly CM, Yang JH, Feng Y, Kennedy SP, Turi TG, et al. (2000). Overexpression of eotaxin and the CCR3 receptor in human atherosclerosis: using genomic technology to identify a potential novel pathway of vascular inflammation. Circulation, 102:2185-2189.
[36] Hoefer J, Luger M, Dal-Pont C, Culig Z, Schennach H, Jochberger S (2017). The "Aging Factor" Eotaxin-1 (CCL11) Is Detectable in Transfusion Blood Products and Increases with the Donor's Age. Front Aging Neurosci, 9:402.
[37] Mo FM, Proia AD, Johnson WH, Cyr D, Lashkari K (2010). Interferon gamma-inducible protein-10 (IP-10) and eotaxin as biomarkers in age-related macular degeneration. Invest Ophthalmol Vis Sci, 51:4226-4236.
[38] Georgalas I, Tservakis I, Papaconstaninou D, Kardara M, Koutsandrea C, Ladas I (2011). Pseudoxanthoma elasticum, ocular manifestations, complications and treatment. Clin Exp Optom, 94:169-180.
[39] Myung JS, Bhatnagar P, Spaide RF, Klancnik JM, Jr., Cooney MJ, Yannuzzi LA, et al. (2010). Long-term outcomes of intravitreal antivascular endothelial growth factor therapy for the management of choroidal neovascularization in pseudoxanthoma elasticum. Retina, 30:748-755.
[40] Ellabban AA, Hangai M, Yamashiro K, Nakagawa S, Tsujikawa A, Yoshimura N (2012). Tomographic fundus features in pseudoxanthoma elasticum: comparison with neovascular age-related macular degeneration in Japanese patients. Eye (Lond), 26:1086-1094.
[41] McPherron AC, Lawler AM, Lee SJ (1999). Regulation of anterior/posterior patterning of the axial skeleton by growth/differentiation factor 11. Nat Genet, 22:260-264.
[42] Egerman MA, Cadena SM, Gilbert JA, Meyer A, Nelson HN, Swalley SE, et al. (2015). GDF11 Increases with Age and Inhibits Skeletal Muscle Regeneration. Cell Metab, 22:164-174.
[43] Smith SC, Zhang X, Gross P, Starosta T, Mohsin S, Franti M, et al. (2015). GDF11 does not rescue aging-related pathological hypertrophy. Circ Res, 117:926-932.
[44] Poggioli T, Vujic A, Yang P, Macias-Trevino C, Uygur A, Loffredo FS, et al. (2016). Circulating Growth Differentiation Factor 11/8 Levels Decline With Age. Circ Res, 118:29-37.
[45] Olson KA, Beatty AL, Heidecker B, Regan MC, Brody EN, Foreman T, et al. (2015). Association of growth differentiation factor 11/8, putative anti-ageing factor, with cardiovascular outcomes and overall mortality in humans: analysis of the Heart and Soul and HUNT3 cohorts. Eur Heart J, 36:3426-3434.
[46] Puche JE, Castilla-Cortazar I (2012). Human conditions of insulin-like growth factor-I (IGF-I) deficiency. J Transl Med, 10:224.
[47] O'Connor KG, Tobin JD, Harman SM, Plato CC, Roy TA, Sherman SS, et al. (1998). Serum levels of insulin-like growth factor-I are related to age and not to body composition in healthy women and men. J Gerontol A Biol Sci Med Sci, 53:M176-182.
[48] Sjogren K, Liu JL, Blad K, Skrtic S, Vidal O, Wallenius V, et al. (1999). Liver-derived insulin-like growth factor I (IGF-I) is the principal source of IGF-I in blood but is not required for postnatal body growth in mice. Proc Natl Acad Sci U S A, 96:7088-7092.
[49] Firth SM, Baxter RC (2002). Cellular actions of the insulin-like growth factor binding proteins. Endocr Rev, 23:824-854.
[50] Kim KS, Kim MS, Seu YB, Chung HY, Kim JH, Kim JR (2007). Regulation of replicative senescence by insulin-like growth factor-binding protein 3 in human umbilical vein endothelial cells. Aging Cell, 6:535-545.
[51] Oliver WT, Rosenberger J, Lopez R, Gomez A, Cummings KK, Fiorotto ML (2005). The local expression and abundance of insulin-like growth factor (IGF) binding proteins in skeletal muscle are regulated by age and gender but not local IGF-I in vivo. Endocrinology, 146:5455-5462.
[52] Lofqvist C, Chen J, Connor KM, Smith AC, Aderman CM, Liu N, et al. (2007). IGFBP3 suppresses retinopathy through suppression of oxygen-induced vessel loss and promotion of vascular regrowth. Proc Natl Acad Sci U S A, 104:10589-10594.
[53] Kuzaj P, Kuhn J, Dabisch-Ruthe M, Faust I, Gotting C, Knabbe C, et al. (2014). ABCC6- a new player in cellular cholesterol and lipoprotein metabolism? Lipids Health Dis, 13:118.
[1] Cho Kyoungjoo. Emerging Roles of Complement Protein C1q in Neurodegeneration[J]. Aging and disease, 2019, 10(3): 652-663.
[2] Gourmelon Robin, Donadio-Andréi Sandrine, Chikh Karim, Rabilloud Muriel, Kuczewski Elisabetta, Gauchez Anne-Sophie, Charrié Anne, Brard Pierre-Yves, Andréani Raphaëlle, Bourre Jean-Cyril, Waterlot Christine, Guédel Domitille, Mayer Anne, Disse Emmanuel, Thivolet Charles, Boullay Hélène Du, Falandry Claire, Gilbert Thomas, François-Joubert Anne, Vignoles Antoine, Ronin Catherine, Bonnefoy Marc. Subclinical Hypothyroidism: is it Really Subclinical with Aging?[J]. Aging and disease, 2019, 10(3): 520-529.
[3] Jin Kunlin. A Microcirculatory Theory of Aging[J]. Aging and disease, 2019, 10(3): 676-683.
[4] Chung Hae Young, Kim Dae Hyun, Lee Eun Kyeong, Chung Ki Wung, Chung Sangwoon, Lee Bonggi, Seo Arnold Y., Chung Jae Heun, Jung Young Suk, Im Eunok, Lee Jaewon, Kim Nam Deuk, Choi Yeon Ja, Im Dong Soon, Yu Byung Pal. Redefining Chronic Inflammation in Aging and Age-Related Diseases: Proposal of the Senoinflammation Concept[J]. Aging and disease, 2019, 10(2): 367-382.
[5] Sarkar Saumyendra N., Russell Ashley E., Engler-Chiurazzi Elizabeth B., Porter Keyana N., Simpkins James W.. MicroRNAs and the Genetic Nexus of Brain Aging, Neuroinflammation, Neurodegeneration, and Brain Trauma[J]. Aging and disease, 2019, 10(2): 329-352.
[6] Cyprien Fabienne, Courtet Philippe, Maller Jerome, Meslin Chantal, Ritchie Karen, Ancelin Marie-Laure, Artero Sylvaine. Increased Serum C-reactive Protein and Corpus Callosum Alterations in Older Adults[J]. Aging and disease, 2019, 10(2): 463-469.
[7] Lana Alberto, Struijk Ellen A., Arias-Fernandez Lucía, Graciani Auxiliadora, Mesas Arthur E., Rodriguez-Artalejo Fernando, Lopez-Garcia Esther. Habitual Meat Consumption and Changes in Sleep Duration and Quality in Older Adults[J]. Aging and disease, 2019, 10(2): 267-277.
[8] Murtha Lucy A., Morten Matthew, Schuliga Michael J., Mabotuwana Nishani S., Hardy Sean A., Waters David W., Burgess Janette K., Ngo Doan TM., Sverdlov Aaron L., Knight Darryl A., Boyle Andrew J.. The Role of Pathological Aging in Cardiac and Pulmonary Fibrosis[J]. Aging and disease, 2019, 10(2): 419-428.
[9] Shetty Ashok K., Upadhya Raghavendra, Madhu Leelavathi N., Kodali Maheedhar. Novel Insights on Systemic and Brain Aging, Stroke, Amyotrophic Lateral Sclerosis, and Alzheimer’s Disease[J]. Aging and disease, 2019, 10(2): 470-482.
[10] Tingting Sui,Di Liu,Tingjun Liu,Jichao Deng,Mao Chen,Yuanyuan Xu,Yuning Song,Hongsheng Ouyang,Liangxue Lai,Zhanjun Li. LMNA-mutated Rabbits: A Model of Premature Aging Syndrome with Muscular Dystrophy and Dilated Cardiomyopathy[J]. Aging and disease, 2019, 10(1): 102-115.
[11] Dong Liu,Liqun Xu,Xiaoyan Zhang,Changhong Shi,Shubin Qiao,Zhiqiang Ma,Jiansong Yuan. Snapshot: Implications for mTOR in Aging-related Ischemia/Reperfusion Injury[J]. Aging and disease, 2019, 10(1): 116-133.
[12] Wanying Duan, Yuehua Pu, Haiyan Liu, Jing Jing, Yuesong Pan, Xinying Zou, Yilong Wang, Xingquan Zhao, Chunxue Wang, Yongjun Wang, Ka Sing Lawrence Wong, Ling Wei, Liping Liu, . Association between Leukoaraiosis and Symptomatic Intracranial Large Artery Stenoses and Occlusions: the Chinese Intracranial Atherosclerosis (CICAS) Study[J]. Aging and disease, 2018, 9(6): 1074-1083.
[13] Calvin Pak-Wing Cheng, Sheung-Tak Cheng, Cindy Woon-Chi Tam, Wai-Chi Chan, Winnie Chiu-Wing Chu, Linda Chiu-Wa Lam. Relationship between Cortical Thickness and Neuropsychological Performance in Normal Older Adults and Those with Mild Cognitive Impairment[J]. Aging and disease, 2018, 9(6): 1020-1030.
[14] Yu-Wen Huang, Ming-Fu Chiang, Che-Sheng Ho, Pi-Lien Hung, Mei-Hsin Hsu, Tsung-Han Lee, Lichieh Julie Chu, Hsuan Liu, Petrus Tang, Wailap Victor Ng, Dar-Shong Lin. A Transcriptome Study of Progeroid Neurocutaneous Syndrome Reveals POSTN As a New Element in Proline Metabolic Disorder[J]. Aging and disease, 2018, 9(6): 1043-1057.
[15] Manuel Scimeca, Federica Centofanti, Monica Celi, Elena Gasbarra, Giuseppe Novelli, Annalisa Botta, Umberto Tarantino. Vitamin D Receptor in Muscle Atrophy of Elderly Patients: A Key Element of Osteoporosis-Sarcopenia Connection[J]. Aging and disease, 2018, 9(6): 952-964.
Viewed
Full text


Abstract

Cited

  Shared   
Copyright © 2014 Aging and Disease, All Rights Reserved.
Address: Aging and Disease Editorial Office 3400 Camp Bowie Boulevard Fort Worth, TX76106 USA
Fax: (817) 735-0408 E-mail: editorial@aginganddisease.org
Powered by Beijing Magtech Co. Ltd