Please wait a minute...
 Home  About the Journal Editorial Board Aims & Scope Peer Review Policy Subscription Contact us
 
Early Edition  //  Current Issue  //  Open Special Issues  //  Archives  //  Most Read  //  Most Downloaded  //  Most Cited
Aging and disease    2020, Vol. 11 Issue (2) : 254-268     DOI: 10.14336/AD.2019.0615
Orginal Article |
Disease Progression-Dependent Expression of CD200R1 and CX3CR1 in Mouse Models of Parkinson’s Disease
Le Wang1, Yang Liu1, Shuxin Yan1, Tianshu Du1, Xia Fu1, Xiaoli Gong2, Xinyu Zhou1, Ting Zhang1,*, Xiaomin Wang1,2,*
1Department of Neurobiology, Center of Parkinson Disease Beijing Institute for Brain Disorders, Beijing Key Laboratory on Parkinson Disease, Key Laboratory for Neurodegenerative Disease of the Ministry of Education, Beijing Key Laboratory of Neural Regeneration and Repair, Capital Medical University, Beijing, China.
2Department of Physiology and Pathophysiology, Capital Medical University, Beijing, China.
Download: PDF(4392 KB)   HTML
Export: BibTeX | EndNote | Reference Manager | ProCite | RefWorks    
Abstract  

Microglial activation is an important contributor to the pathogenesis of Parkinson’s disease (PD). Microglia are tightly and efficiently regulated by immune checkpoints, including CD200-CD200R1 and CX3CL1-CX3CR1. Understanding the involvement of these checkpoints in disease progression provides important insights into how microglial activation contributes to PD pathology. However, so far, studies have produced seemingly conflicting results. In this study, we demonstrate that CD200R1 expression is down-regulated at both early and late stage of PD model, and CX3CR1 expression is down-regulated in early stage and recovered in late stage. In primary cultured microglia, CD200R1 and CX3CR1 expressions are both directly regulated by LPS or α-synuclein, and CD200R1 expression is more sensitively regulated than CX3CR1. In addition, CD200 knockout causes an increase in proinflammatory cytokine production and microglial activation in the midbrain. Remarkably, DA neurons in the substantial nigra are degenerated in CD200-/- mice. Finally, activation of the CD200R with CD200Fc alleviates the neuroinflammation in microglia. Together, these results suggest that immune checkpoints play distinct functional roles in different stage of PD pathology, and the CD200-CD200R1 axis plays a significant role in nigrostriatal neuron viability and function.

Keywords microglia      Parkinson’s disease      CD200      CD200R1      CX3CL1      CX3CR1     
Corresponding Authors: Zhang Ting,Wang Xiaomin   
About author:

Present address: Captor Therapeutics Inc, Wrocław, Poland.

Just Accepted Date: 05 July 2019   Issue Date: 13 March 2020
Service
E-mail this article
E-mail Alert
RSS
Articles by authors
Wang Le
Liu Yang
Yan Shuxin
Du Tianshu
Fu Xia
Gong Xiaoli
Zhou Xinyu
Zhang Ting
Wang Xiaomin
Cite this article:   
Wang Le,Liu Yang,Yan Shuxin, et al. Disease Progression-Dependent Expression of CD200R1 and CX3CR1 in Mouse Models of Parkinson’s Disease[J]. Aging and disease, 2020, 11(2): 254-268.
URL:  
http://www.aginganddisease.org/EN/10.14336/AD.2019.0615     OR
GeneGen-Bank IDSequences (5’ - 3’)
mouse-CD200NM_010818.3Forward: CTGTGAGGGATTTGACTTTTTGC
Reverse: CCGAGGCACTCGACTTCCT
mouse-CD200R1NM_021325.3Forward: GGAAAACCAGAAAACCGAAATG
Reverse: CCCCCATATTAAGAGCACTGCTA
mouse-TNF-αNM_013693.3Forward: CCAGTGTGGGAAGCTGTCTT
Reverse: AAGCAAAAGAGGAGGCAACA
mouse-IL-1βNM_008361.4Forward: CTGGTGTGTGACGTTCCCATTA
Reverse: CCGACAGCACGAGGCTTT
mouse-CX3CL1NM_009142.3Forward: TGGCTTTGCTCATCCGCTAT
Reverse: CTGTGTCGTCTCCAGGACAAT
mouse-CX3CR1NM_009987.4Forward: CAAGCTCACGACTGCCTTCT
Reverse: CTGCACTGTCCGGTTGTTCA
mouse-GAPDHNM_001289726.1Forward: AGAACATCATCCCTGCATCC
Reverse: CACATTGGGGGTAGGAACAC
rat-CD200R1NM_023953.1Forward: GTCCTTGGATGGGCATTTA
Reverse: TGCGGAGATTCACCACAA
rat-CX3CR1NM_133534.1Forward: TCCCTTGTCTTCACGTTCGG
Reverse: ACAAAGAGCAGGTCGCTCAA
rat-IL-1βNM_031512.2Forward: AAATGCCTCGTGCTGTCTGA
Reverse: TGGAGAATACCACTTGTTGGC
rat-IL-6NM_012589.2Forward: GCCCACCAGGAACGAAAGTC
Reverse: TGGCTGGAAGTCTCTTGCGG
rat-PPARγNM_013124.3Forward: GGAGATCCTCCTGTTGACCC
Reverse: TGGTAATTTCTTGTGAAGTGCTCA
rat-C/EBPβNM_024125.5Forward: ACCACGACTTCCTTTCCGAC
Reverse: TAACCGTAGTCGGACGGCTT
rat-GAPDHNM_017008.4Forward: AGAACATCATCCCTGCATCC
Reverse: CACATTGGGGGTAGGAACAC
Table 1  Primers used for RT-qPCR.
Figure 1.  The temporal expression of CD200R1 and CX3CR1 in the early and late stages of LPS-induced PD. A single dose of LPS (5 mg/kg, i.p.) or N.S. control (ctr) was administered. (A) Representative immunofluorescent images of Iba1+ microglia 3 h after LPS injection (5 mg/kg, i.p.). Scale bar = 75 μm. Red, Iba1; blue, Hoechst. (B, C) The quantification of the number (B) and cell body size (C) of Iba1+ cells 3 h after LPS injection (n = 5-8 per group, 10 cells per mouse). The mice were sacrificed at different time points after LPS or control injection (9 hours or 10 months) for the analysis of TNF-α (D), IL-1β (E), CD200R1 (F), CD200 (G), CX3CR1 (H) and CX3CL1 (I) levels in the midbrain by RT-qPCR (n = 5-6 per group). (J and K) Representative immunochemical images (J) and the quantification of the number of TH+ dopamine neurons (K) in the SNpc 10 months after LPS injection. Scale bar = 200 μm (n = 6 per group). Microglia were isolated from the brains (excluding the cerebellum) 9 hours after LPS or control injection for the analysis of CX3CR1 (L) and CD200R1 (M) levels by RT-qPCR (n = 4 per group). The data are expressed as the mean ± SEM. * p < 0.05, ** p < 0.01 and *** p < 0.001 versus the ctr group, Student’s t test.
Figure 2.  CD200R1 and CX3CR1 expression is downregulated by LPS in microglia. Primary cultured microglia were stimulated with different concentrations of LPS (0.01, 0.1, and 1 μg/ml). Twenty-four hours later, IL-1β (A) and IL-6 (B) expression was tested by RT-qPCR and ELISA. CD200R1 (C, D) and CX3CR1 (C, E) protein expression was tested by RT-qPCR and Western blot. CD200R1 (F) and CX3CR1 (G) mRNA expressions were observed by RT-qPCR. (H) Representative immunofluorescent images of CD200R1 expression in microglia 24 h after LPS (1 μg/ml) treatment. Scale bar = 10 μm. Green, CD200R1; blue, Hoechst. (I) The quantification of CD200R1 staining intensity in microglia (n = 5 per group). PPAR-γ (J) and C/EBPβ (K) expression was tested by RT-qPCR. The data are expressed as the mean ± SEM (n = 3 per group). * p < 0.05, ** p < 0.01 and *** p < 0.001 versus the ctr group, Student’s t test or one-way ANOVA. ## p < 0.05, ## p < 0.01 and ### p < 0.001 versus the ctr group, one-way ANOVA.
Figure 3.  The characterization of the rAAV-hSYN-injected mouse model of PD. Two-month-old C57BL/6 mice received a unilateral stereotactic injection of rAAV9-hSYN into the right SNpc to generate a mouse model of PD. Two weeks postinjection, (A) the mice were sacrificed, and brain slices were stained with a human-specific α-syn antibody (αsyn 211, red). Green, TH. Scale bar = 250 μm. (B) A higher magnification image showing TH+ neurons expressing exogenous α-syn. Scale bar = 25 μm. The rotarod test (C) and cylinder test (D) were performed 4, 8 and 16 weeks after rAAV-hSYN injection (n = 5-13 per group). Representative immunochemical images (E) and the quantification of the number of TH+ neurons (F) in the SNpc at 8 weeks after rAAV-hSYN injection (n = 11 per group). Scale bar = 200 μm. (G) Quantification of changes in TH immunoreactivity in the ipsilateral striatum of CD200 -/- and WT mice in a mouse PD model at 8 weeks after intra-SNpc infection (n = 11 per group). (H) Representative immunochemical images of TH immunostaining of the striatum. Scale bar = 1.0 mm. The data are expressed as the mean ± SEM. * p < 0.05 and *** p < 0.001 versus the ctr group, Student’s t test or one-way ANOVA.
Figure 4.  The temporal expression of CD200R1 and CX3CR1 in the early and late stages of PD. C57BL/6 mice received a unilateral stereotactic injection of recombinant AAV encoding human full-length α-syn (rAAV9-hSYN) (3.67×1013 viral genomes/ml) into the right SNpc. The mice were sacrificed 2 weeks and 8 weeks postinjection. (A) Representative immunofluorescent images of Iba1+ microglia in the SNpc of a mouse model of PD. Scale bar = 250 μm. Red, Iba1; green, TH; blue, Hoechst. (B) Higher magnification images of Iba1+ microglia in the ipsilateral SN of the control group and PD group. Scale bar = 15 μm. Red, Iba1; blue, Hoechst. (C, D) The quantification of the Iba1 staining intensity (C) and cell body size (D) of Iba1+ cells (n = 5-8 per group, 10 cells per mouse). The mice were sacrificed at different time points after virus injection (2 weeks or 8 weeks) for the analysis of TNF-α (E), IL-1β (F), CD200R1 (G), CX3CR1 (H), CD200 (I) and CX3CL1 (J) levels in the midbrain by RT-qPCR. The data are expressed as the mean ± SEM (n = 5 per group). * p < 0.05, ** p < 0.01 and *** p < 0.001 versus the ctr group, Student’s t test.
Figure 5.  CD200R1 is more sensitively regulated by α-syn in microglia. Primary cultured microglia were prepared from the cerebral cortices of SD rats (P0) and stimulated with different concentrations of monomeric recombinant human α-syn protein (0.01, 0.1, 1 and 10 μM). After 24 h, IL-1β (A) and IL-6 (B) expression and release were evaluated by RT-qPCR and ELISA. CD200R1 (C, D) and CX3CR1 (C, E) expression was tested by RT-qPCR and Western blot. CD200R1 (F) and CX3CR1 (G) mRNA expressions were observed by RT-qPCR. (H) Representative immunofluorescent images of CD200R1 expression in microglia 24 h after α-syn (1 μM) stimulation. Scale bar = 10 μm. Green, CD200R1; blue, Hoechst. (I) The quantification of CD200R1 staining intensity in microglia (n = 5 per group). PPAR-γ (J) and C/EBPβ (K) expression was tested by RT-qPCR. The data are expressed as the mean ± SEM (n = 3 per group). * p < 0.05, ** p < 0.01 and *** p < 0.001 versus the ctr group, Student’s t test or one-way ANOVA. ## p < 0.01 and ### p < 0.001 versus the ctr group, one-way ANOVA.
Figure 6.  CD200 deficiency induces microglial activation and dopaminergic neuron death in SNpc. (A) Representative immunofluorescent images of Iba1+ microglia in the SN of CD200-/- and WT mice at 3 months of age. Scale bar = 10 μm. Green, Iba1; blue, Hoechst. (B) The quantification of the cell body size of Iba1+ cells (n = 8 per group). TNF-α (C) and IL-1β (D) mRNA expression in the midbrain of 3- and 5-month-old CD200-/- and WT mice, as detected by RT-qPCR (n = 6 per group). (E) Representative TH immunostaining images illustrating the morphology of DA neurons and the stereological quantification of TH+ neurons (F) in CD200-/- and WT mice at 3, 5 and 10 months of age. Scale bar = 200 μm. (n = 5 per group). The data are expressed as the mean ± SEM. * p < 0.05, ** p < 0.01 and *** p < 0.001 versus the WT mice, Student’s t test.
Figure 7.  CD200Fc attenuates cytokine production and the decrease in CD200R1 induced by LPS or α-syn in microglia. Primary cultured microglia were pretreated with CD200Fc (2.5 μg/ml) for 30 min and then exposed to monomeric recombinant human α-syn protein (1 μM) or LPS (1 μg/ml) for 24 h. IL-1β and IL-6 expression was evaluated by RT-qPCR (A, B) and ELISA (C, D). (E) CD200R1 expression was tested by RT-qPCR (E) and immunofluorescent staining (F, G) in microglia treated with α-syn or LPS and treated with or without CD200Fc. Scale bar = 10 μm. Green, CD200R1; blue, Hoechst. (n = 5 per group). The data are expressed as the mean ± SEM (n = 3 per group). * p < 0.05, ** p < 0.01 and *** p < 0.001 versus the ctr group, one-way ANOVA. # p < 0.05 and ### p < 0.001 versus the α-syn or LPS group, one-way ANOVA.
[1] Kalia LV, Lang AE (2015). Parkinson's disease. Lancet, 386:896-912.
[2] Joers V, Tansey MG, Mulas G, Carta AR (2017). Microglial phenotypes in Parkinson's disease and animal models of the disease. Prog Neurobiol, 155:57-75.
[3] Imamura K, Hishikawa N, Sawada M, Nagatsu T, Yoshida M, Hashizume Y (2003). Distribution of major histocompatibility complex class II-positive microglia and cytokine profile of Parkinson's disease brains. Acta Neuropathol, 106:518-526.
[4] McGeer PL, Itagaki S, Boyes BE, McGeer EG (1988). Reactive microglia are positive for HLA-DR in the substantia nigra of Parkinson's and Alzheimer's disease brains. Neurology, 38:1285-1291.
[5] Gerhard A, Pavese N, Hotton G, Turkheimer F, Es M, Hammers A, et al. (2006). In vivo imaging of microglial activation with [11C](R)-PK11195 PET in idiopathic Parkinson's disease. Neurobiol Dis, 21:404-412.
[6] Ouchi Y, Yagi S, Yokokura M, Sakamoto M (2009). Neuroinflammation in the living brain of Parkinson's disease. Parkinsonism Relat Disord, 15 Suppl 3:S200-204.
[7] Deczkowska A, Amit I, Schwartz M (2018). Microglial immune checkpoint mechanisms. Nat Neurosci, 21:779-786.
[8] Kierdorf K, Prinz M (2013). Factors regulating microglia activation. Front Cell Neurosci, 7:44.
[9] Cardona AE, Pioro EP, Sasse ME, Kostenko V, Cardona SM, Dijkstra IM, et al. (2006). Control of microglial neurotoxicity by the fractalkine receptor. Nat Neurosci, 9:917-924.
[10] Castro-Sanchez S, Garcia-Yague AJ, Lopez-Royo T, Casarejos M, Lanciego JL, Lastres-Becker I (2018). Cx3cr1-deficiency exacerbates alpha-synuclein-A53T induced neuroinflammation and neurodegeneration in a mouse model of Parkinson's disease. Glia.
[11] Zhang S, Wang XJ, Tian LP, Pan J, Lu GQ, Zhang YJ, et al. (2011). CD200-CD200R dysfunction exacerbates microglial activation and dopaminergic neurodegeneration in a rat model of Parkinson's disease. J Neuroinflammation, 8:154.
[12] Finneran DJ, Nash KR (2019). Neuroinflammation and fractalkine signaling in Alzheimer's disease. J Neuroinflammation, 16:30.
[13] Luo P, Chu SF, Zhang Z, Xia CY, Chen NH (2019). Fractalkine/CX3CR1 is involved in the cross-talk between neuron and glia in neurological diseases. Brain Res Bull, 146:12-21.
[14] Morganti JM, Nash KR, Grimmig BA, Ranjit S, Small B, Bickford PC, et al. (2012). The soluble isoform of CX3CL1 is necessary for neuroprotection in a mouse model of Parkinson's disease. J Neurosci, 32:14592-14601.
[15] Shan S, Hong-Min T, Yi F, Jun-Peng G, Yue F, Yan-Hong T, et al. (2011). New evidences for fractalkine/CX3CL1 involved in substantia nigral microglial activation and behavioral changes in a rat model of Parkinson's disease. Neurobiol Aging, 32:443-458.
[16] Wynne AM, Henry CJ, Huang Y, Cleland A, Godbout JP (2010). Protracted downregulation of CX3CR1 on microglia of aged mice after lipopolysaccharide challenge. Brain Behav Immun, 24:1190-1201.
[17] Liu B, Gao HM, Hong JS (2003). Parkinson's disease and exposure to infectious agents and pesticides and the occurrence of brain injuries: role of neuroinflammation. Environ Health Perspect, 111:1065-1073.
[18] Minas K, Liversidge J (2006). Is the CD200/CD200 receptor interaction more than just a myeloid cell inhibitory signal? Crit Rev Immunol, 26:213-230.
[19] Wang XJ, Ye M, Zhang YH, Chen SD (2007). CD200-CD200R regulation of microglia activation in the pathogenesis of Parkinson's disease. J Neuroimmune Pharmacol, 2:259-264.
[20] Masocha W (2009). Systemic lipopolysaccharide (LPS)-induced microglial activation results in different temporal reduction of CD200 and CD200 receptor gene expression in the brain. J Neuroimmunol, 214:78-82.
[21] Sung YH, Kim SC, Hong HP, Park CY, Shin MS, Kim CJ, et al. (2012). Treadmill exercise ameliorates dopaminergic neuronal loss through suppressing microglial activation in Parkinson's disease mice. Life Sci, 91:1309-1316.
[22] Ren Y, Ye M, Chen S, Ding J (2016). CD200 Inhibits Inflammatory Response by Promoting KATP Channel Opening in Microglia Cells in Parkinson's Disease. Med Sci Monit, 22:1733-1741.
[23] Cohen M, Ben-Yehuda H, Porat Z, Raposo C, Gordon S, Schwartz M (2017). Newly Formed Endothelial Cells Regulate Myeloid Cell Activity Following Spinal Cord Injury via Expression of CD200 Ligand. J Neurosci, 37:972-985.
[24] Zhang T, Gong XL, Hu GZ, Wang XM (2015). EP2-PKA signaling is suppressed by triptolide in lipopolysaccharide-induced microglia activation. Journal of Neuroinflammation, 12.
[25] Gong Y, Xue B, Jiao J, Jing L, Wang X (2008). Triptolide inhibits COX-2 expression and PGE2 release by suppressing the activity of NF-kappaB and JNK in LPS-treated microglia. J Neurochem, 107:779-788.
[26] Oliveras-Salva M, Van der Perren A, Casadei N, Stroobants S, Nuber S, D'Hooge R, et al. (2013). rAAV2/7 vector-mediated overexpression of alpha-synuclein in mouse substantia nigra induces protein aggregation and progressive dose-dependent neurodegeneration. Molecular Neurodegeneration, 8.
[27] Zhang L, Hao J, Zheng Y, Su R, Liao Y, Gong X, et al. (2018). Fucoidan Protects Dopaminergic Neurons by Enhancing the Mitochondrial Function in a Rotenone-induced Rat Model of Parkinson's Disease. Aging Dis, 9:590-604.
[28] Wang Y, Cella M, Mallinson K, Ulrich JD, Young KL, Robinette ML, et al. (2015). TREM2 lipid sensing sustains the microglial response in an Alzheimer's disease model. Cell, 160:1061-1071.
[29] Gao HM, Zhou H, Zhang F, Wilson BC, Kam W, Hong JS (2011). HMGB1 acts on microglia Mac1 to mediate chronic neuroinflammation that drives progressive neurodegeneration. J Neurosci, 31:1081-1092.
[30] Qin L, Wu X, Block ML, Liu Y, Breese GR, Hong JS, et al. (2007). Systemic LPS causes chronic neuroinflammation and progressive neurodegeneration. Glia, 55:453-462.
[31] Dentesano G, Straccia M, Ejarque-Ortiz A, Tusell JM, Serratosa J, Saura J, et al. (2012). Inhibition of CD200R1 expression by C/EBP beta in reactive microglial cells. J Neuroinflammation, 9:165.
[32] Dentesano G, Serratosa J, Tusell JM, Ramon P, Valente T, Saura J, et al. (2014). CD200R1 and CD200 expression are regulated by PPAR-gamma in activated glial cells. Glia, 62:982-998.
[33] Walsh S, Finn DP, Dowd E (2011). Time-course of nigrostriatal neurodegeneration and neuroinflammation in the 6-hydroxydopamine-induced axonal and terminal lesion models of Parkinson's disease in the rat. Neuroscience, 175:251-261.
[34] Marinova-Mutafchieva L, Sadeghian M, Broom L, Davis JB, Medhurst AD, Dexter DT (2009). Relationship between microglial activation and dopaminergic neuronal loss in the substantia nigra: a time course study in a 6-hydroxydopamine model of Parkinson's disease. J Neurochem, 110:966-975.
[35] Kurkowska-Jastrzebska I, Wronska A, Kohutnicka M, Czlonkowski A, Czlonkowska A (1999). The inflammatory reaction following 1-methyl-4-phenyl-1,2,3, 6-tetrahydropyridine intoxication in mouse. Exp Neurol, 156:50-61.
[36] Kohutnicka M, Lewandowska E, Kurkowska-Jastrzebska I, Czlonkowski A, Czlonkowska A (1998). Microglial and astrocytic involvement in a murine model of Parkinson's disease induced by 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP). Immunopharmacology, 39:167-180.
[37] Thakur P, Breger LS, Lundblad M, Wan OW, Mattsson B, Luk KC, et al. (2017). Modeling Parkinson's disease pathology by combination of fibril seeds and alpha-synuclein overexpression in the rat brain. Proc Natl Acad Sci U S A, 114:E8284-E8293.
[38] Barkholt P, Sanchez-Guajardo V, Kirik D, Romero-Ramos M (2012). Long-term polarization of microglia upon alpha-synuclein overexpression in nonhuman primates. Neuroscience, 208:85-96.
[39] Sanchez-Guajardo V, Febbraro F, Kirik D, Romero-Ramos M (2010). Microglia acquire distinct activation profiles depending on the degree of alpha-synuclein neuropathology in a rAAV based model of Parkinson's disease. PLoS One, 5:e8784.
[40] Theodore S, Cao S, McLean PJ, Standaert DG (2008). Targeted overexpression of human alpha-synuclein triggers microglial activation and an adaptive immune response in a mouse model of Parkinson disease. J Neuropathol Exp Neurol, 67:1149-1158.
[41] Decressac M, Mattsson B, Bjorklund A (2012). Comparison of the behavioural and histological characteristics of the 6-OHDA and alpha-synuclein rat models of Parkinson's disease. Exp Neurol, 235:306-315.
[42] Visanji NP, Brotchie JM, Kalia LV, Koprich JB, Tandon A, Watts JC, et al. (2016). alpha-Synuclein-Based Animal Models of Parkinson's Disease: Challenges and Opportunities in a New Era. Trends Neurosci, 39:750-762.
[43] Riederer P, Wuketich S (1976). Time course of nigrostriatal degeneration in parkinson's disease. A detailed study of influential factors in human brain amine analysis. J Neural Transm, 38:277-301.
[44] Bezard E, Dovero S, Prunier C, Ravenscroft P, Chalon S, Guilloteau D, et al. (2001). Relationship between the appearance of symptoms and the level of nigrostriatal degeneration in a progressive 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine-lesioned macaque model of Parkinson's disease. J Neurosci, 21:6853-6861.
[45] Salvatore MF, Terrebonne J, Cantu MA, McInnis TR, Venable K, Kelley P, et al. (2017). Dissociation of Striatal Dopamine and Tyrosine Hydroxylase Expression from Aging-Related Motor Decline: Evidence from Calorie Restriction Intervention. J Gerontol A Biol Sci Med Sci, 73:11-20.
[46] Emborg ME, Ma SY, Mufson EJ, Levey AI, Taylor MD, Brown WD, et al. (1998). Age-related declines in nigral neuronal function correlate with motor impairments in rhesus monkeys. J Comp Neurol, 401:253-265.
[47] Trevitt JT, Carlson BB, Nowend K, Salamone JD (2001). Substantia nigra pars reticulata is a highly potent site of action for the behavioral effects of the D1 antagonist SCH 23390 in the rat. Psychopharmacology (Berl), 156:32-41.
[48] Salvatore MF, McInnis TR, Cantu MA, Apple DM, Pruett BS (2019). Tyrosine Hydroxylase Inhibition in Substantia Nigra Decreases Movement Frequency. Mol Neurobiol, 56:2728-2740.
[49] (2012). Retraction of "Pathological biochemistry of a-synucleinopathy" by Takeshi Iwatsubo, published online on 18 September2007. Neuropathology, 32:318.
[50] Su X, Maguire-Zeiss KA, Giuliano R, Prifti L, Venkatesh K, Federoff HJ (2008). Synuclein activates microglia in a model of Parkinson's disease. Neurobiol Aging, 29:1690-1701.
[51] Brown GC, Neher JJ (2014). Microglial phagocytosis of live neurons. Nat Rev Neurosci, 15:209-216.
[52] Hoek RM, Ruuls SR, Murphy CA, Wright GJ, Goddard R, Zurawski SM, et al. (2000). Down-regulation of the macrophage lineage through interaction with OX2 (CD200). Science, 290:1768-1771.
[53] Keren-Shaul H, Spinrad A, Weiner A, Matcovitch-Natan O, Dvir-Szternfeld R, Ulland TK, et al. (2017). A Unique Microglia Type Associated with Restricting Development of Alzheimer's Disease. Cell, 169:1276-1290 e1217.
[54] Deczkowska A, Keren-Shaul H, Weiner A, Colonna M, Schwartz M, Amit I (2018). Disease-Associated Microglia: A Universal Immune Sensor of Neurodegeneration. Cell, 173:1073-1081.
[55] Jay TR, Hirsch AM, Broihier ML, Miller CM, Neilson LE, Ransohoff RM, et al. (2017). Disease Progression-Dependent Effects of TREM2 Deficiency in a Mouse Model of Alzheimer's Disease. J Neurosci, 37:637-647.
[56] Wolf SA, Boddeke HW, Kettenmann H (2017). Microglia in Physiology and Disease. Annu Rev Physiol, 79:619-643.
[57] Santoni G, Cardinali C, Morelli MB, Santoni M, Nabissi M, Amantini C (2015). Danger- and pathogen-associated molecular patterns recognition by pattern-recognition receptors and ion channels of the transient receptor potential family triggers the inflammasome activation in immune cells and sensory neurons. J Neuroinflammation, 12:21.
[1] Supplementary data Download
[1] Yuan Tan, Minjing Ke, Zhijian Huang, Cheong-Meng Chong, Xiaotong Cen, Jia-Hong Lu, Xiaoli Yao, Dajiang Qin, Huanxing Su. Hydroxyurea Facilitates Manifestation of Disease Relevant Phenotypes in Patients-Derived IPSCs-Based Modeling of Late-Onset Parkinson’s Disease[J]. Aging and disease, 2019, 10(5): 1037-1048.
[2] Elizabeth Qian, Yue Huang. Subtyping of Parkinson’s Disease - Where Are We Up To?[J]. Aging and disease, 2019, 10(5): 1130-1139.
[3] Jinghui Xu, Xiaodi Fu, Mengqiu Pan, Xiao Zhou, Zhaoyu Chen, Dongmei Wang, Xiaomei Zhang, Qiong Chen, Yanhui Li, Xiaoxian Huang, Guanghui Liu, Jianjun Lu, Yan Liu, Yafang Hu, Suyue Pan, Qing Wang, Qun Wang, Yunqi Xu. Mitochondrial Creatine Kinase is Decreased in the Serum of Idiopathic Parkinson’s Disease Patients[J]. Aging and disease, 2019, 10(3): 601-610.
[4] Kyoungjoo Cho. Emerging Roles of Complement Protein C1q in Neurodegeneration[J]. Aging and disease, 2019, 10(3): 652-663.
[5] Yong-Fei Zhao, Qiong Zhang, Jian-Feng Zhang, Zhi-Yin Lou, Hen-Bing Zu, Zi-Gao Wang, Wei-Cheng Zeng, Kai Yao, Bao-Guo Xiao. The Synergy of Aging and LPS Exposure in a Mouse Model of Parkinson’s Disease[J]. Aging and disease, 2018, 9(5): 785-797.
[6] Zhang Li, Hao Junwei, Zheng Yan, Su Ruijun, Liao Yajin, Gong Xiaoli, Liu Limin, Wang Xiaomin. Fucoidan Protects Dopaminergic Neurons by Enhancing the Mitochondrial Function in a Rotenone-induced Rat Model of Parkinson’s Disease[J]. Aging and disease, 2018, 9(4): 590-604.
[7] De Lazzari Federica, Bubacco Luigi, Whitworth Alexander J, Bisaglia Marco. Superoxide Radical Dismutation as New Therapeutic Strategy in Parkinson’s Disease[J]. Aging and disease, 2018, 9(4): 716-728.
[8] Han Ziping, Zhao Haiping, Tao Zhen, Wang Rongliang, Fan Zhibin, Luo Yumin, Luo Yinghao, Ji Xunming. TOPK Promotes Microglia/Macrophage Polarization towards M2 Phenotype via Inhibition of HDAC1 and HDAC2 Activity after Transient Cerebral Ischemia[J]. Aging and disease, 2018, 9(2): 235-248.
[9] Zhang Meng, Deng Yong-Ning, Zhang Jing-Yi, Liu Jie, Li Yan-Bo, Su Hua, Qu Qiu-Min. SIRT3 Protects Rotenone-induced Injury in SH-SY5Y Cells by Promoting Autophagy through the LKB1-AMPK-mTOR Pathway[J]. Aging and disease, 2018, 9(2): 273-286.
[10] Perez-Roca Laia, Adame-Castillo Cristina, Campdelacreu Jaume, Ispierto Lourdes, Vilas Dolores, Rene Ramon, Alvarez Ramiro, Gascon-Bayarri Jordi, Serrano-Munoz Maria A., Ariza Aurelio, Beyer Katrin. Glucocerebrosidase mRNA is Diminished in Brain of Lewy Body Diseases and Changes with Disease Progression in Blood[J]. Aging and disease, 2018, 9(2): 208-219.
[11] Sun Qian, Wang Tian, Jiang Tian-Fang, Huang Pei, Wang Ying, Xiao Qin, Liu Jun, Chen Sheng-Di. Clinical Profile of Chinese Long-Term Parkinson’s Disease Survivors With 10 Years of Disease Duration and Beyond[J]. Aging and disease, 2018, 9(1): 8-16.
[12] Wang Rongliang, Li Jincheng, Duan Yunxia, Tao Zhen, Zhao Haiping, Luo Yumin. Effects of Erythropoietin on Gliogenesis during Cerebral Ischemic/Reperfusion Recovery in Adult Mice[J]. Aging and disease, 2017, 8(4): 410-419.
[13] Lv Deyong, Li Jingbo, Li Hongfu, Fu Yu, Wang Wei. Imaging and Quantitative Analysis of the Interstitial Space in the Caudate Nucleus in a Rotenone-Induced Rat Model of Parkinson’s Disease Using Tracer-based MRI[J]. Aging and disease, 2017, 8(1): 1-6.
[14] Su Ruijun, Sun Min, Wang Wei, Zhang Jianliang, Zhang Li, Zhen Junli, Qian Yanjing, Zheng Yan, Wang Xiaomin. A Novel Immunosuppressor, (5R)-5-Hydroxytriptolide, Alleviates Movement Disorder and Neuroinflammation in a 6-OHDA Hemiparkinsonian Rat Model[J]. Aging and disease, 2017, 8(1): 31-43.
[15] Ma Qingfeng, Zhao Haiping, Tao Zhen, Wang Rongliang, Liu Ping, Han Ziping, Ma Shubei, Luo Yumin, Jia Jianping. MicroRNA-181c Exacerbates Brain Injury in Acute Ischemic Stroke[J]. Aging and disease, 2016, 7(6): 705-714.
Viewed
Full text


Abstract

Cited

  Shared   
Copyright © 2014 Aging and Disease, All Rights Reserved.
Address: Aging and Disease Editorial Office 3400 Camp Bowie Boulevard Fort Worth, TX76106 USA
Fax: (817) 735-0408 E-mail: editorial@aginganddisease.org
Powered by Beijing Magtech Co. Ltd