Please wait a minute...
 Home  About the Journal Editorial Board Aims & Scope Peer Review Policy Subscription Contact us
 
Early Edition  //  Current Issue  //  Open Special Issues  //  Archives  //  Most Read  //  Most Downloaded  //  Most Cited
Aging and disease
Orginal Article |
Disease Progression-Dependent Expression of CD200R1 and CX3CR1 in Mouse Models of Parkinson’s Disease
Le Wang1, Yang Liu1, Shuxin Yan1, Tianshu Du1, Xia Fu1, Xiaoli Gong2, Xinyu Zhou1, Ting Zhang1, Xiaomin Wang1,2,*
1Department of Neurobiology, Center of Parkinson Disease Beijing Institute for Brain Disorders, Beijing Key Laboratory on Parkinson Disease, Key Laboratory for Neurodegenerative Disease of the Ministry of Education, Beijing Key Laboratory of Neural Regeneration and Repair, Capital Medical University, Beijing, China.
2Department of Physiology and Pathophysiology, Capital Medical University, Beijing, China.
Download: PDF(1332 KB)   HTML
Export: BibTeX | EndNote | Reference Manager | ProCite | RefWorks    
Abstract  

Microglial activation is an important contributor to the pathogenesis of Parkinson’s disease (PD). Microglia are tightly and efficiently regulated by immune checkpoints, including CD200-CD200R1 and CX3CL1-CX3CR1. Understanding the involvement of these checkpoints in disease progression provides important insights into how microglial activation contributes to PD pathology. However, so far, studies have produced seemingly conflicting results. In this study, we demonstrate that CD200R1 expression is down-regulated at both early and late stage of PD model, and CX3CR1 expression is down-regulated in early stage and recovered in late stage. In primary cultured microglia, CD200R1 and CX3CR1 expressions are both directly regulated by LPS or α-synuclein, and CD200R1 expression is more sensitively regulated than CX3CR1. In addition, CD200 knockout causes an increase in proinflammatory cytokine production and microglial activation in the midbrain. Remarkably, DA neurons in the substantial nigra are degenerated in CD200-/- mice. Finally, activation of the CD200R with CD200Fc alleviates the neuroinflammation in microglia. Together, these results suggest that immune checkpoints play distinct functional roles in different stage of PD pathology, and the CD200-CD200R1 axis plays a significant role in nigrostriatal neuron viability and function.

Keywords microglia      Parkinson’s disease      CD200      CD200R1      CX3CL1      CX3CR1     
Corresponding Authors: Xiaomin Wang   
Just Accepted Date: 05 July 2019  
Service
E-mail this article
E-mail Alert
RSS
Articles by authors
Le Wang
Yang Liu
Shuxin Yan
Tianshu Du
Xia Fu
Xiaoli Gong
Xinyu Zhou
Ting Zhang
Xiaomin Wang
Cite this article:   
Le Wang,Yang Liu,Shuxin Yan, et al. Disease Progression-Dependent Expression of CD200R1 and CX3CR1 in Mouse Models of Parkinson’s Disease[J]. Aging and disease, 10.14336/AD.2019.0615
URL:  
http://www.aginganddisease.org/EN/10.14336/AD.2019.0615     OR     http://www.aginganddisease.org/EN/Y/V/I/0
GeneGen-Bank IDSequences (5’ - 3’)
mouse-CD200NM_010818.3Forward: CTGTGAGGGATTTGACTTTTTGC
Reverse: CCGAGGCACTCGACTTCCT
mouse-CD200R1NM_021325.3Forward: GGAAAACCAGAAAACCGAAATG
Reverse: CCCCCATATTAAGAGCACTGCTA
mouse-TNF-αNM_013693.3Forward: CCAGTGTGGGAAGCTGTCTT
Reverse: AAGCAAAAGAGGAGGCAACA
mouse-IL-1βNM_008361.4Forward: CTGGTGTGTGACGTTCCCATTA
Reverse: CCGACAGCACGAGGCTTT
mouse-CX3CL1NM_009142.3Forward: TGGCTTTGCTCATCCGCTAT
Reverse: CTGTGTCGTCTCCAGGACAAT
mouse-CX3CR1NM_009987.4Forward: CAAGCTCACGACTGCCTTCT
Reverse: CTGCACTGTCCGGTTGTTCA
mouse-GAPDHNM_001289726.1Forward: AGAACATCATCCCTGCATCC
Reverse: CACATTGGGGGTAGGAACAC
rat-CD200R1NM_023953.1Forward: GTCCTTGGATGGGCATTTA
Reverse: TGCGGAGATTCACCACAA
rat-CX3CR1NM_133534.1Forward: TCCCTTGTCTTCACGTTCGG
Reverse: ACAAAGAGCAGGTCGCTCAA
rat-IL-1βNM_031512.2Forward: AAATGCCTCGTGCTGTCTGA
Reverse: TGGAGAATACCACTTGTTGGC
rat-IL-6NM_012589.2Forward: GCCCACCAGGAACGAAAGTC
Reverse: TGGCTGGAAGTCTCTTGCGG
rat-PPARγNM_013124.3Forward: GGAGATCCTCCTGTTGACCC
Reverse: TGGTAATTTCTTGTGAAGTGCTCA
rat-C/EBPβNM_024125.5Forward: ACCACGACTTCCTTTCCGAC
Reverse: TAACCGTAGTCGGACGGCTT
rat-GAPDHNM_017008.4Forward: AGAACATCATCCCTGCATCC
Reverse: CACATTGGGGGTAGGAACAC
Table 1  Primers used for RT-qPCR.
Figure 1.  The temporal expression of CD200R1 and CX3CR1 in early and late stage of LPS model. A single dose of LPS (5 mg/kg, i.p.) or N.S. control (Ctr) was administered. (A) Representative immunofluorescent images of Iba1+ microglia at 3 h after LPS injection (5 mg/kg, i.p.). Scale bar = 75 μm. Red, Iba1; blue, Hoechst. (B, C) Quantification of the number (B) and body size (C) of Iba1+ cells at 3 h after LPS injection (n = 5-8 per group, 10 cells per mice). Mice were sacrificed at different time points after LPS or control injection (9 hours and 10 months) for analysis of TNF-α (D), IL-1β (E), CD200R1 (F), CD200 (G), CX3CR1 (H) and CX3CL1 (I) levels in the midbrain by RT-qPCR assays (n = 5-6 per group). (J, K) Representative immunochemical images (J) and quantification of the number of TH+ dopamine neurons (K) in the SNpc at 10 months after LPS injection. Scale bar = 200 μm (n = 6 per group). Microglia were isolated from the brains without cerebellum at 9 hours after LPS or control injection for analysis of CX3CR1 (L) and CD200R1 (M) levels by RT-qPCR assays (n = 4 per group). Data are expressed as mean ± SEM. * p < 0.05, ** p < 0.01 and *** p < 0.001 versus ctr group, Student’s t test.
Figure 2.  CD200R1 and CX3CR1 expressions are downregulated by LPS in microglia. Primary cultured microglia were stimulated with different concentrations of LPS (0.01, 0.1, 1 μg/ml). 24 h later, IL-1β (A) and IL-6 (B) expressions were tested by RT-qPCR and ELISA. CD200R1 (C, D) and CX3CR1 (C, E) protein expressions were tested by RT-qPCR and Western blot. CD200R1 (F) and CX3CR1 (G) mRNA expressions were observed by RT-qPCR. (H) Representative immunofluorescent images of CD200R1 expression in microglia at 24 h after LPS (1μg/ml) treatment. Scale bar = 10 μm. Green, CD200R1; blue, Hoechst. (I) Quantification of CD200R1 staining intensity in microglia (n = 5 per group). PPAR-γ (J) and C/EBPβ (K) expressions were tested by RT-qPCR. Data are expressed as mean ± SEM (n = 3 per group). * p < 0.05, ** p < 0.01 and *** p < 0.001 versus ctr group, Student’s t test or one-way ANOVA. ## p < 0.05, ## p < 0.01 and ### p < 0.001 versus ctr group, one-way ANOVA.
Figure 3.  The temporal expression of CD200R1 and CX3CR1 in early and late stage of PD model. C57BL/6 mice received a unilateral stereotactic injection of recombinant AAV encoding human full-length α-syn (rAAV9-hSYN) (3.67×1013 viral genome/ml) into the right SNpc. Mice were sacrificed at 2 weeks and 8 weeks post-injection. (A) Representative immunofluorescent images of Iba1+ microglia in SNpc of a mouse PD model. Scale bar = 250 μm. Red, Iba1; Green, TH; Blue, Hoechst. (B) Higher magnification images of Iba1+ microglia in the ipsilateral SN of control group and PD group. Scale bar = 15 μm. Red, Iba1; Blue, Hoechst. (C, D) Quantification of the Iba1 staining intensity (C) and body size (D) of Iba1+ cells (n = 5-8 per group, 10 cells per mice). Mice were sacrificed at different time points after virus injection (2 weeks and 8 weeks) for analysis of TNF-α (E), IL-1β (F), CD200R1 (G), CX3CR1 (H), CD200 (I) and CX3CL1 (J) levels in the midbrain by RT-qPCR assays. Data are expressed as mean ± SEM (n = 5 per group). * p < 0.05, ** p < 0.01 and *** p < 0.001 versus ctr group, Student’s t test.
Figure 4.  CD200R1 is more sensitively regulated by α-syn in microglia. Primary cultured microglia were prepared from cerebral cortices of SD rats (P0) and stimulated with different concentrations of monomeric recombinant human α-syn protein (0.01, 0.1, 1 and 10 μM). 24 h later, IL-1β (A) and IL-6 (B) expression and release was evaluated by RT-qPCR and ELISA. CD200R1 (C, D) and CX3CR1 (C, E) protein expressions were tested by RT-qPCR and Western blot. CD200R1 (F) and CX3CR1 (G) mRNA expressions were observed by RT-qPCR. (H) Representative immunofluorescent images of CD200R1 expression in microglia at 24 h after α-syn (1 μM) stimulation. Scale bar = 10 μm. Green, CD200R1; blue, Hoechst. (I) Quantification of CD200R1 staining intensity in microglia (n = 5 per group). PPAR-γ (J) and C/EBPβ (K) expressions were tested by RT-qPCR. Data are expressed as mean ± SEM (n = 3 per group). * p < 0.05, ** p < 0.01 and *** p < 0.001 versus ctr group, Student’s t test or one-way ANOVA. ## p < 0.01 and ### p < 0.001 versus ctr group, one-way ANOVA.
Figure 5.  CD200 deficiency induced microglia activation and dopaminergic neuron death in SNpc. (A) Representative immunofluorescent images of Iba1+ microglia in the SN of CD200-/- and WT mice at 3 months old. Scale bar = 10 μm. Green, Iba1; Blue, Hoechst. (B) Quantification of the body size of Iba1+ cells (n = 8 per group). TNF-α (C) and IL-1β (D) mRNA expression in the midbrain of 3 and 5 months old CD200-/- and WT mice as detected by RT-qPCR assays (n = 6 per group). (E) Representative TH immunostaining images illustrating morphology of DA neurons and stereological quantification of TH+ neurons (F) in CD200-/- and WT mice at 3, 5 and 10-month old. Scale bar = 200 μm. (n = 5 per group). Data are expressed as mean ± SEM. * p < 0.05, ** p < 0.01 and *** p < 0.001 versus WT mice, Student’s t-test.
Figure 6.  CD200Fc attenuated cytokine production and CD200R1 decrease induced by LPS or α-syn in microglia. Primary cultured microglia were pre-treated with CD200Fc (2.5 μg/ml) for 30 minutes and then exposed to monomeric recombinant human α-syn protein (1 μM) or LPS (1 μg/ml) for 24 h. IL-1β and IL-6 expression was evaluated by RT-qPCR (A, B) and ELISA (C, D). (E) CD200R1 expression is tested by RT-qPCR (E) and immunofluorescent staining (F, G) in microglia treated by α-syn or LPS, with or without CD200Fc. Scale bar = 10 μm. Green, CD200R1; blue, Hoechst. (n = 5 per group). Data are expressed as mean ± SEM (n = 3 per group). * p < 0.05, ** p < 0.01 and *** p < 0.001 versus ctr group, one-way ANOVA. # p < 0.05 and ### p < 0.001 versus syn or LPS group, one-way ANOVA.
[1] Kalia LV, Lang AE (2015). Parkinson's disease. Lancet, 386:896-912.
[2] Joers V, Tansey MG, Mulas G, Carta AR (2017). Microglial phenotypes in Parkinson's disease and animal models of the disease. Prog Neurobiol, 155:57-75.
[3] Imamura K, Hishikawa N, Sawada M, Nagatsu T, Yoshida M, Hashizume Y (2003). Distribution of major histocompatibility complex class II-positive microglia and cytokine profile of Parkinson's disease brains. Acta Neuropathol, 106:518-526.
[4] McGeer PL, Itagaki S, Boyes BE, McGeer EG (1988). Reactive microglia are positive for HLA-DR in the substantia nigra of Parkinson's and Alzheimer's disease brains. Neurology, 38:1285-1291.
[5] Gerhard A, Pavese N, Hotton G, Turkheimer F, Es M, Hammers A, et al. (2006). In vivo imaging of microglial activation with [11C](R)-PK11195 PET in idiopathic Parkinson's disease. Neurobiol Dis, 21:404-412.
[6] Ouchi Y, Yagi S, Yokokura M, Sakamoto M (2009). Neuroinflammation in the living brain of Parkinson's disease. Parkinsonism Relat Disord, 15 Suppl 3:S200-204.
[7] Deczkowska A, Amit I, Schwartz M (2018). Microglial immune checkpoint mechanisms. Nat Neurosci, 21:779-786.
[8] Kierdorf K, Prinz M (2013). Factors regulating microglia activation. Front Cell Neurosci, 7:44.
[9] Cardona AE, Pioro EP, Sasse ME, Kostenko V, Cardona SM, Dijkstra IM, et al. (2006). Control of microglial neurotoxicity by the fractalkine receptor. Nat Neurosci, 9:917-924.
[10] Castro-Sanchez S, Garcia-Yague AJ, Lopez-Royo T, Casarejos M, Lanciego JL, Lastres-Becker I (2018). Cx3cr1-deficiency exacerbates alpha-synuclein-A53T induced neuroinflammation and neurodegeneration in a mouse model of Parkinson's disease. Glia.
[11] Zhang S, Wang XJ, Tian LP, Pan J, Lu GQ, Zhang YJ, et al. (2011). CD200-CD200R dysfunction exacerbates microglial activation and dopaminergic neurodegeneration in a rat model of Parkinson's disease. J Neuroinflammation, 8:154.
[12] Morganti JM, Nash KR, Grimmig BA, Ranjit S, Small B, Bickford PC, et al. (2012). The soluble isoform of CX3CL1 is necessary for neuroprotection in a mouse model of Parkinson's disease. J Neurosci, 32:14592-14601.
[13] Shan S, Hong-Min T, Yi F, Jun-Peng G, Yue F, Yan-Hong T, et al. (2011). New evidences for fractalkine/CX3CL1 involved in substantia nigral microglial activation and behavioral changes in a rat model of Parkinson's disease. Neurobiol Aging, 32:443-458.
[14] Wynne AM, Henry CJ, Huang Y, Cleland A, Godbout JP (2010). Protracted downregulation of CX3CR1 on microglia of aged mice after lipopolysaccharide challenge. Brain Behav Immun, 24:1190-1201.
[15] Masocha W (2009). Systemic lipopolysaccharide (LPS)-induced microglial activation results in different temporal reduction of CD200 and CD200 receptor gene expression in the brain. J Neuroimmunol, 214:78-82.
[16] Sung YH, Kim SC, Hong HP, Park CY, Shin MS, Kim CJ, et al. (2012). Treadmill exercise ameliorates dopaminergic neuronal loss through suppressing microglial activation in Parkinson's disease mice. Life Sci, 91:1309-1316.
[17] Ren Y, Ye M, Chen S, Ding J (2016). CD200 Inhibits Inflammatory Response by Promoting KATP Channel Opening in Microglia Cells in Parkinson's Disease. Med Sci Monit, 22:1733-1741.
[18] Cohen M, Ben-Yehuda H, Porat Z, Raposo C, Gordon S, Schwartz M (2017). Newly Formed Endothelial Cells Regulate Myeloid Cell Activity Following Spinal Cord Injury via Expression of CD200 Ligand. J Neurosci, 37:972-985.
[19] Zhang T, Gong XL, Hu GZ, Wang XM (2015). EP2-PKA signaling is suppressed by triptolide in lipopolysaccharide-induced microglia activation. Journal of Neuroinflammation, 12.
[20] Gong Y, Xue B, Jiao J, Jing L, Wang X (2008). Triptolide inhibits COX-2 expression and PGE2 release by suppressing the activity of NF-kappaB and JNK in LPS-treated microglia. J Neurochem, 107:779-788.
[21] Ren X, Zhang T, Gong X, Hu G, Ding W, Wang X (2013). AAV2-mediated striatum delivery of human CDNF prevents the deterioration of midbrain dopamine neurons in a 6-hydroxydopamine induced parkinsonian rat model. Exp Neurol, 248:148-156.
[22] Wang Y, Cella M, Mallinson K, Ulrich JD, Young KL, Robinette ML, et al. (2015). TREM2 lipid sensing sustains the microglial response in an Alzheimer's disease model. Cell, 160:1061-1071.
[23] Gao HM, Zhou H, Zhang F, Wilson BC, Kam W, Hong JS (2011). HMGB1 acts on microglia Mac1 to mediate chronic neuroinflammation that drives progressive neurodegeneration. J Neurosci, 31:1081-1092.
[24] Qin L, Wu X, Block ML, Liu Y, Breese GR, Hong JS, et al. (2007). Systemic LPS causes chronic neuroinflammation and progressive neurodegeneration. Glia, 55:453-462.
[25] Dentesano G, Straccia M, Ejarque-Ortiz A, Tusell JM, Serratosa J, Saura J, et al. (2012). Inhibition of CD200R1 expression by C/EBP beta in reactive microglial cells. J Neuroinflammation, 9:165.
[26] Dentesano G, Serratosa J, Tusell JM, Ramon P, Valente T, Saura J, et al. (2014). CD200R1 and CD200 expression are regulated by PPAR-gamma in activated glial cells. Glia, 62:982-998.
[27] Walsh S, Finn DP, Dowd E (2011). Time-course of nigrostriatal neurodegeneration and neuroinflammation in the 6-hydroxydopamine-induced axonal and terminal lesion models of Parkinson's disease in the rat. Neuroscience, 175:251-261.
[28] Marinova-Mutafchieva L, Sadeghian M, Broom L, Davis JB, Medhurst AD, Dexter DT (2009). Relationship between microglial activation and dopaminergic neuronal loss in the substantia nigra: a time course study in a 6-hydroxydopamine model of Parkinson's disease. J Neurochem, 110:966-975.
[29] Kurkowska-Jastrzebska I, Wronska A, Kohutnicka M, Czlonkowski A, Czlonkowska A (1999). The inflammatory reaction following 1-methyl-4-phenyl-1,2,3, 6-tetrahydropyridine intoxication in mouse. Exp Neurol, 156:50-61.
[30] Kohutnicka M, Lewandowska E, Kurkowska-Jastrzebska I, Czlonkowski A, Czlonkowska A (1998). Microglial and astrocytic involvement in a murine model of Parkinson's disease induced by 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP). Immunopharmacology, 39:167-180.
[31] Thakur P, Breger LS, Lundblad M, Wan OW, Mattsson B, Luk KC, et al. (2017). Modeling Parkinson's disease pathology by combination of fibril seeds and alpha-synuclein overexpression in the rat brain. Proc Natl Acad Sci U S A, 114:E8284-E8293.
[32] Barkholt P, Sanchez-Guajardo V, Kirik D, Romero-Ramos M (2012). Long-term polarization of microglia upon alpha-synuclein overexpression in nonhuman primates. Neuroscience, 208:85-96.
[33] Sanchez-Guajardo V, Febbraro F, Kirik D, Romero-Ramos M (2010). Microglia acquire distinct activation profiles depending on the degree of alpha-synuclein neuropathology in a rAAV based model of Parkinson's disease. PLoS One, 5:e8784.
[34] Theodore S, Cao S, McLean PJ, Standaert DG (2008). Targeted overexpression of human alpha-synuclein triggers microglial activation and an adaptive immune response in a mouse model of Parkinson disease. J Neuropathol Exp Neurol, 67:1149-1158.
[35] Oliveras-Salva M, Van der Perren A, Casadei N, Stroobants S, Nuber S, D'Hooge R, et al. (2013). rAAV2/7 vector-mediated overexpression of alpha-synuclein in mouse substantia nigra induces protein aggregation and progressive dose-dependent neurodegeneration. Molecular Neurodegeneration, 8.
[36] Decressac M, Mattsson B, Bjorklund A (2012). Comparison of the behavioural and histological characteristics of the 6-OHDA and alpha-synuclein rat models of Parkinson's disease. Exp Neurol, 235:306-315.
[37] Visanji NP, Brotchie JM, Kalia LV, Koprich JB, Tandon A, Watts JC, et al. (2016). alpha-Synuclein-Based Animal Models of Parkinson's Disease: Challenges and Opportunities in a New Era. Trends Neurosci, 39:750-762.
[38] Su X, Maguire-Zeiss KA, Giuliano R, Prifti L, Venkatesh K, Federoff HJ (2008). Synuclein activates microglia in a model of Parkinson's disease. Neurobiol Aging, 29:1690-1701.
[39] Brown GC, Neher JJ (2014). Microglial phagocytosis of live neurons. Nat Rev Neurosci, 15:209-216.
[40] Hoek RM, Ruuls SR, Murphy CA, Wright GJ, Goddard R, Zurawski SM, et al. (2000). Down-regulation of the macrophage lineage through interaction with OX2 (CD200). Science, 290:1768-1771.
[41] Keren-Shaul H, Spinrad A, Weiner A, Matcovitch-Natan O, Dvir-Szternfeld R, Ulland TK, et al. (2017). A Unique Microglia Type Associated with Restricting Development of Alzheimer's Disease. Cell, 169:1276-1290 e1217.
[42] Deczkowska A, Keren-Shaul H, Weiner A, Colonna M, Schwartz M, Amit I (2018). Disease-Associated Microglia: A Universal Immune Sensor of Neurodegeneration. Cell, 173:1073-1081.
[43] Jay TR, Hirsch AM, Broihier ML, Miller CM, Neilson LE, Ransohoff RM, et al. (2017). Disease Progression-Dependent Effects of TREM2 Deficiency in a Mouse Model of Alzheimer's Disease. J Neurosci, 37:637-647.
[44] Wolf SA, Boddeke HW, Kettenmann H (2017). Microglia in Physiology and Disease. Annu Rev Physiol, 79:619-643.
[45] Santoni G, Cardinali C, Morelli MB, Santoni M, Nabissi M, Amantini C (2015). Danger- and pathogen-associated molecular patterns recognition by pattern-recognition receptors and ion channels of the transient receptor potential family triggers the inflammasome activation in immune cells and sensory neurons. J Neuroinflammation, 12:21.
[1] Supplementary data Download
[1] Xu Jinghui, Fu Xiaodi, Pan Mengqiu, Zhou Xiao, Chen Zhaoyu, Wang Dongmei, Zhang Xiaomei, Chen Qiong, Li Yanhui, Huang Xiaoxian, Liu Guanghui, Lu Jianjun, Liu Yan, Hu Yafang, Pan Suyue, Wang Qing, Wang Qun, Xu Yunqi. Mitochondrial Creatine Kinase is Decreased in the Serum of Idiopathic Parkinson’s Disease Patients[J]. Aging and disease, 2019, 10(3): 601-610.
[2] Cho Kyoungjoo. Emerging Roles of Complement Protein C1q in Neurodegeneration[J]. Aging and disease, 2019, 10(3): 652-663.
[3] Yong-Fei Zhao, Qiong Zhang, Jian-Feng Zhang, Zhi-Yin Lou, Hen-Bing Zu, Zi-Gao Wang, Wei-Cheng Zeng, Kai Yao, Bao-Guo Xiao. The Synergy of Aging and LPS Exposure in a Mouse Model of Parkinson’s Disease[J]. Aging and disease, 2018, 9(5): 785-797.
[4] Zhang Li, Hao Junwei, Zheng Yan, Su Ruijun, Liao Yajin, Gong Xiaoli, Liu Limin, Wang Xiaomin. Fucoidan Protects Dopaminergic Neurons by Enhancing the Mitochondrial Function in a Rotenone-induced Rat Model of Parkinson’s Disease[J]. Aging and disease, 2018, 9(4): 590-604.
[5] De Lazzari Federica, Bubacco Luigi, Whitworth Alexander J, Bisaglia Marco. Superoxide Radical Dismutation as New Therapeutic Strategy in Parkinson’s Disease[J]. Aging and disease, 2018, 9(4): 716-728.
[6] Han Ziping, Zhao Haiping, Tao Zhen, Wang Rongliang, Fan Zhibin, Luo Yumin, Luo Yinghao, Ji Xunming. TOPK Promotes Microglia/Macrophage Polarization towards M2 Phenotype via Inhibition of HDAC1 and HDAC2 Activity after Transient Cerebral Ischemia[J]. Aging and disease, 2018, 9(2): 235-248.
[7] Zhang Meng, Deng Yong-Ning, Zhang Jing-Yi, Liu Jie, Li Yan-Bo, Su Hua, Qu Qiu-Min. SIRT3 Protects Rotenone-induced Injury in SH-SY5Y Cells by Promoting Autophagy through the LKB1-AMPK-mTOR Pathway[J]. Aging and disease, 2018, 9(2): 273-286.
[8] Perez-Roca Laia, Adame-Castillo Cristina, Campdelacreu Jaume, Ispierto Lourdes, Vilas Dolores, Rene Ramon, Alvarez Ramiro, Gascon-Bayarri Jordi, Serrano-Munoz Maria A., Ariza Aurelio, Beyer Katrin. Glucocerebrosidase mRNA is Diminished in Brain of Lewy Body Diseases and Changes with Disease Progression in Blood[J]. Aging and disease, 2018, 9(2): 208-219.
[9] Sun Qian, Wang Tian, Jiang Tian-Fang, Huang Pei, Wang Ying, Xiao Qin, Liu Jun, Chen Sheng-Di. Clinical Profile of Chinese Long-Term Parkinson’s Disease Survivors With 10 Years of Disease Duration and Beyond[J]. Aging and disease, 2018, 9(1): 8-16.
[10] Wang Rongliang, Li Jincheng, Duan Yunxia, Tao Zhen, Zhao Haiping, Luo Yumin. Effects of Erythropoietin on Gliogenesis during Cerebral Ischemic/Reperfusion Recovery in Adult Mice[J]. Aging and disease, 2017, 8(4): 410-419.
[11] Lv Deyong, Li Jingbo, Li Hongfu, Fu Yu, Wang Wei. Imaging and Quantitative Analysis of the Interstitial Space in the Caudate Nucleus in a Rotenone-Induced Rat Model of Parkinson’s Disease Using Tracer-based MRI[J]. Aging and disease, 2017, 8(1): 1-6.
[12] Su Ruijun, Sun Min, Wang Wei, Zhang Jianliang, Zhang Li, Zhen Junli, Qian Yanjing, Zheng Yan, Wang Xiaomin. A Novel Immunosuppressor, (5R)-5-Hydroxytriptolide, Alleviates Movement Disorder and Neuroinflammation in a 6-OHDA Hemiparkinsonian Rat Model[J]. Aging and disease, 2017, 8(1): 31-43.
[13] Ma Qingfeng, Zhao Haiping, Tao Zhen, Wang Rongliang, Liu Ping, Han Ziping, Ma Shubei, Luo Yumin, Jia Jianping. MicroRNA-181c Exacerbates Brain Injury in Acute Ischemic Stroke[J]. Aging and disease, 2016, 7(6): 705-714.
[14] Smirnova Natalya A., Kaidery Navneet Ammal, Hushpulian Dmitry M., Rakhman Ilay I., Poloznikov Andrey A., Tishkov Vladimir I., Karuppagounder Saravanan S., Gaisina Irina N., Pekcec Anton, Leyen Klaus Van, Kazakov Sergey V., Yang Lichuan, Thomas Bobby, Ratan Rajiv R., Gazaryan Irina G.. Bioactive Flavonoids and Catechols as Hif1 and Nrf2 Protein Stabilizers - Implications for Parkinson’s Disease[J]. Aging and disease, 2016, 7(6): 745-762.
[15] Sun Qian, Wang Tian, Jiang Tian-Fang, Huang Pei, Li Dun-Hui, Wang Ying, Xiao Qin, Liu Jun, Chen Sheng-Di. Effect of a Leucine-rich Repeat Kinase 2 Variant on Motor and Non-motor Symptoms in Chinese Parkinson’s Disease Patients[J]. Aging and disease, 2016, 7(3): 230-236.
Viewed
Full text


Abstract

Cited

  Shared   
Copyright © 2014 Aging and Disease, All Rights Reserved.
Address: Aging and Disease Editorial Office 3400 Camp Bowie Boulevard Fort Worth, TX76106 USA
Fax: (817) 735-0408 E-mail: editorial@aginganddisease.org
Powered by Beijing Magtech Co. Ltd