Please wait a minute...
 Home  About the Journal Editorial Board Aims & Scope Peer Review Policy Subscription Contact us
 
Early Edition  //  Current Issue  //  Open Special Issues  //  Archives  //  Most Read  //  Most Downloaded  //  Most Cited
Aging and disease
Orginal Article |
lncRNA Xist Regulates Osteoblast Differentiation by Sponging miR-19a-3p in Aging-induced Osteoporosis
Shijie Chen1,2, Yuezhan Li1, Shuang Zhi4, Zhiyu Ding1, Yan Huang5, Weiguo Wang1, Ruping Zheng6, Haiyang Yu6, Jianlong Wang1, Minghua Hu3, Jinglei Miao1,*, Jinsong Li1,*

1Department of Orthopaedics, The Third Xiangya Hospital of Central South University, Changsha, China.
2Shanghai Key Laboratory of Regulatory Biology, Institute of Biomedical Sciences and School of Life Sciences, East China Normal University, Shanghai, China.
3Department of Anatomy, Histology and Embryology, Changsha Medical University, Changsha, China.
4Four Gynecological Wards, Ningbo Women & Children’s Hospital, Ningbo, Zhejiang, China.
5The Second Xiangya Hospital of Central South University, Changsha, China.
6School of Basic Medical Science, Central South University, Changsha, China.
Download: PDF(1154 KB)   HTML
Export: BibTeX | EndNote | Reference Manager | ProCite | RefWorks    
Abstract  

The switch between osteogenic and adipogenic differentiation of bone marrow mesenchymal stem cells (BMSCs) plays a key role in aging-induced osteoporosis. In this study, miR-19a-3p was obviously downregulated in BMSCs from aged humans and mice. Overexpressed miR-19a-3p evidently reduced aging-induced bone loss in mice and promoted osteogenic differentiation of BMSCs, while silenced miR-19a-3p manifestly increased aging-induced bone loss in mice and repressed osteogenic differentiation of BMSCs. Hoxa5 was significantly downregulated in the BMSCs from aged mice and contribute to miR-19a-3p-induced osteoblast differentiation as a direct target gene of miR-19a-3p. Furthermore, lncRNA Xist was found as a sponge of miR-19a-3p to repress BMSCs osteogenic differentiation. In conclusion, our study reveals the critical role of the lncRNA Xist/miR-19a-3p/Hoxa5 pathway in aging-induced osteogenic differentiation of BMSCs, indicating the potential therapeutic target for osteoporosis.

Keywords Osteoporosis      BMSCs      miR-19a-3p      Hoxa5      lncRNA Xist     
Corresponding Authors: Jinglei Miao,Jinsong Li   
About author:

These authors contributed equally to this work.

Just Accepted Date: 27 October 2019  
Service
E-mail this article
E-mail Alert
RSS
Articles by authors
Shijie Chen
Yuezhan Li
Shuang Zhi
Zhiyu Ding
Yan Huang
Weiguo Wang
Ruping Zheng
Haiyang Yu
Jianlong Wang
Minghua Hu
Jinglei Miao
Jinsong Li
Cite this article:   
Shijie Chen,Yuezhan Li,Shuang Zhi, et al. lncRNA Xist Regulates Osteoblast Differentiation by Sponging miR-19a-3p in Aging-induced Osteoporosis[J]. Aging and disease, 10.14336/AD.2019.0724
URL:  
http://www.aginganddisease.org/EN/10.14336/AD.2019.0724     OR     http://www.aginganddisease.org/EN/Y/V/I/0
Forward 5’-3’Reverse 5’-3’
β-actin CTGTCCCTGTATGCCTCTGTGATGTCACGCACGATTT
Runx2 ACTTCCTGTGCTCCGTGCTGTCGTTGAACCTGGCTACTTGG
Hoxa5CTCATTTTGCGGTCGCTATCCATCCATGCCATTGTAGCCGTA
OsterixACCAGGTCCAGGCAACACGCAAAGTCAGATGGGTAAGTAG
miR-19a-3pCTGGAGTGTGCAAATCTATGCGTGCAGGGTCCGAGGT
LncRNA XistAATGGAACGGGCTGAGTTTTAGTCATCCGCTTGCGTTCATAG
U6GCGCGTCGTGAAGCGTTCGTGCAGGGTCCGAGGT
Antagomir-19a-3pTCAGTTTTGCATAGATTTGCACA
antagomir NCCAGUACUUUUGUGUAGUACAA
agomir-19a-3pUGUGCAAAUCUAUGCAAAACUGA
pGL3-HOXA5GGGGTACC GCATCTGAGCGCCGCTCGAG GCTGATCACAGTT
pGL3-XistGGGGTACCCGGCTTGCTCCACCGCTCGAG TTCAAAACAAAGCA
pcDNA3.1-HOXA5GGGGTACC ATGAGCTCTTATTCCGCTCGAG TCAGGGGCGGAA
pcDNA3.1-XistGGGGTACCCGGCTTGCTCCACCGCTCGAG TTCAAAACAAAGCA
siHOXA5GCACATTAGTCACGACAAT
si_controlGCATTAGTCACGACCAAAT
siXistGCACACATCTCATTCCATT
Table 1  The primers.
Figure 1.  Aging induces miR-19a-3p expression in BMSCs. A The miR-19a-3p expression in BMSCs from mice with different ages. B, The relationship between miR-19a-3p expression with age in BMSCs from 61 human females and C, 62 males. Data shown as mean ± SD. *p < 0.05.
Figure 2.  The age-associated bone loss in miR-19a-3p Tg mice. (A) The μCT images of WT mice and miR-19a-3p Tg mice at 1, 3 and 12 months old. B-E, quantitative μCT analysis of trabecular bone microarchitecture. (B) Tb. BV/TV, trabecular bone volume per tissue volume. (C) Tb.N, trabecular number. (D) Tb.Th, trabecular thickness. E, Tb.Sp, trabecular separation. (F, G) Representative images of calcein double labelling of trabecular bone, (G) with quantification of BFR per bone surface BFR/BS, H, and mineral apposition rate MAR. Data shown as mean ± SD, *p <0.05.
Figure 3.  Age-associated bone loss in miR-19a-3p knockout mice. (A) μCT images of WT mice and miR-19a-3p -/- mice at 1, 3 and 12 months old. B-E, quantitative the trabecular bone microarchitecture. (B) Tb. BV/TV, trabecular bone volume per tissue volume. (C) Tb.N, trabecular number. (D) Tb.Th, trabecular thickness. (E) Tb.Sp, trabecular separation. (F, G) quantification of BFR/BS and MAR. (F) with quantification of BFR per bone surface (BFR/BS); (G) mineral apposition rate (MAR). Data shown as mean ± SD. *p <0.05.
Figure 4.  miR-19a-3p regulates the osteogenic differentiation in BMSCs. (A) miR-19a-3p expression in the BMSCs during osteogenic differentiation. (B) The antagomiR-19a-3p or agomiR-19a-3p were used to silence or overexpress miR-19a-3p in BMSCs. (C, D) Alizarin Red staining revealed the role of miR-19a-3p on the osteogenic differentiation of BMSCs. Scale bars: 100 μm. (E) ALP activity, (F) osteocalcin secretion, (G) RUNX2 and H, osterix expression in BMSCs. Data shown as mean ± SD. *p <0.05.
Figure 5.  miR-19a-3p regulated Hoxa5 expression by targeting the 3’UTR of Hoxa5 directly. (A) the predict binding role of miR-19a-3p on 3′-UTR of Hoxa5. (B) luciferase reporter assay revealed the target role of miR-19a-3p on Hoxa5. (C) miR-19a-3p regulated Hoxa5 expression. (D) Hoxa5 expression was increased in BMSCs of the aging mice. (E, F) The role of Hoxa5 and miR-19a-3p on ALP activity of BMSCs. (G, F) The role of Hoxa5 and miR-19a-3p on osteocalcin secretion of BMSCs. Data shown as mean ± SD. *p <0.05.
Figure 6.  LncRNA Xist was involved osteoblast differentiation via miR-19a-3p/Hoxa5 pathway. (A) Xist expression in BMSCs from mice with different age. (B) RNA FISH assay for miR-19a-3p and Xist. Scale bar=10 µm. (C) BMSCs were incubated with biotin-labeled miR-19a-3p and Xist, and qPCR analyses revealed the production of pulled down. (D) RIP assay to reveal the relationship between miR-19a-3p and Xist. (E) Luciferase reporter assay revealed the target role of miR-19a-3p and Xist. (F) The role of Xist and miR-19a-3p on Hoxa5 expression in BMSCs. (G) The effects of Xist and miR-19a-3p on ALP activity. H, The role of Xist and miR-19a-3p on osteocalcin secretion in BMSCs. Data shown as mean ± SD. *p <0.05.
[1] Collison J (2017). Bone: miR-106b promotes osteoporosis in mice. Nat Rev Rheumatol, 13:130.
[2] Jing H, Su X, Gao B, Shuai Y, Chen J, Deng Z, et al. (2018). Epigenetic inhibition of Wnt pathway suppresses osteogenic differentiation of BMSCs during osteoporosis. Cell Death Dis, 9:176.
[3] Li CJ, Cheng P, Liang MK, Chen YS, Lu Q, Wang JY, et al. (2015). MicroRNA-188 regulates age-related switch between osteoblast and adipocyte differentiation. J Clin Invest, 125:1509-1522.
[4] Guo Q, Chen Y, Guo L, Jiang T, Lin Z (2016). miR-23a/b regulates the balance between osteoblast and adipocyte differentiation in bone marrow mesenchymal stem cells. Bone Res, 4:16022.
[5] Huang J, Zhao L, Xing L, Chen D (2010). MicroRNA-204 regulates Runx2 protein expression and mesenchymal progenitor cell differentiation. Stem Cells, 28:357-364.
[6] Yang J, Zhang Z, Chen C, Liu Y, Si Q, Chuang TH, et al. (2014). MicroRNA-19a-3p inhibits breast cancer progression and metastasis by inducing macrophage polarization through downregulated expression of Fra-1 proto-oncogene. Oncogene, 33:3014-3023.
[7] Chen H, Li X, Liu S, Gu L, Zhou X (2017). MircroRNA-19a promotes vascular inflammation and foam cell formation by targeting HBP-1 in atherogenesis. Sci Rep, 7:12089.
[8] Wang N, Li R, Xue M (2019). Potential regulatory network in the PSG10P/miR-19a-3p/IL1RAP pathway is possibly involved in preeclampsia pathogenesis. J Cell Mol Med, 23:852-864.
[9] Qiao F, Gong P, Song Y, Shen X, Su X, Li Y, et al. (2018). Downregulated PITX1 Modulated by MiR-19a-3p Promotes Cell Malignancy and Predicts a Poor Prognosis of Gastric Cancer by Affecting Transcriptionally Activated PDCD5. Cell Physiol Biochem, 46:2215-2231.
[10] Lee S, Lee H, Bae H, Choi EH, Kim SJ (2016). Epigenetic silencing of miR-19a-3p by cold atmospheric plasma contributes to proliferation inhibition of the MCF-7 breast cancer cell. Sci Rep, 6:30005.
[11] Zhang B, Liu Y, Zhang J (2019). Silencing of miR-19a-3p enhances osteosarcoma cells chemosensitivity by elevating the expression of tumor suppressor PTEN. Oncol Lett, 17:414-421.
[12] Wang Z, Shi Z, Zhang L, Zhang H, Zhang Y (2019). Profilin 1, negatively regulated by microRNA-19a-3p, serves as a tumor suppressor in human hepatocellular carcinoma. Pathol Res Pract, 215:499-505.
[13] Gu Y, Liu S, Zhang X, Chen G, Liang H, Yu M, et al. (2017). Oncogenic miR-19a and miR-19b co-regulate tumor suppressor MTUS1 to promote cell proliferation and migration in lung cancer. Protein Cell, 8:455-466.
[14] Yang M, Li CJ, Sun X, Guo Q, Xiao Y, Su T, et al. (2017). MiR-497 approximately 195 cluster regulates angiogenesis during coupling with osteogenesis by maintaining endothelial Notch and HIF-1alpha activity. Nat Commun, 8:16003.
[15] Iliopoulos D, Bimpaki EI, Nesterova M, Stratakis CA (2009). MicroRNA signature of primary pigmented nodular adrenocortical disease: clinical correlations and regulation of Wnt signaling. Cancer Res, 69:3278-3282.
[16] Wang R, Zhang S, Chen X, Li N, Li J, Jia R, et al. (2018). CircNT5E Acts as a Sponge of miR-422a to Promote Glioblastoma Tumorigenesis. Cancer Res, 78:4812-4825.
[17] Cheng X, Zhang L, Zhang K, Zhang G, Hu Y, Sun X, et al. (2018). Circular RNA VMA21 protects against intervertebral disc degeneration through targeting miR-200c and X linked inhibitor-of-apoptosis protein. Ann Rheum Dis, 77:770-779.
[18] Liao L, Su X, Yang X, Hu C, Li B, Lv Y, et al. (2016). TNF-alpha Inhibits FoxO1 by Upregulating miR-705 to Aggravate Oxidative Damage in Bone Marrow-Derived Mesenchymal Stem Cells during Osteoporosis. Stem Cells, 34:1054-1067.
[19] Wang Y, Wang K, Hu Z, Zhou H, Zhang L, Wang H, et al. (2018). MicroRNA-139-3p regulates osteoblast differentiation and apoptosis by targeting ELK1 and interacting with long noncoding RNA ODSM. Cell Death Dis, 9:1107.
[20] Zhu J, Wang S, Chen Y, Li X, Jiang Y, Yang X, et al. (2017). miR-19 targeting of GSK3beta mediates sulforaphane suppression of lung cancer stem cells. J Nutr Biochem, 44:80-91.
[21] Wang T, Xu X, Xu Q, Ren J, Shen S, Fan C, et al. (2017). miR-19a promotes colitis-associated colorectal cancer by regulating tumor necrosis factor alpha-induced protein 3-NF-kappaB feedback loops. Oncogene, 36:3240-3251.
[22] Xu XM, Wang XB, Chen MM, Liu T, Li YX, Jia WH, et al. (2012). MicroRNA-19a and -19b regulate cervical carcinoma cell proliferation and invasion by targeting CUL5. Cancer Lett, 322:148-158.
[23] Haj-Salem I, Fakhfakh R, Berube JC, Jacques E, Plante S, Simard MJ, et al. (2015). MicroRNA-19a enhances proliferation of bronchial epithelial cells by targeting TGFbetaR2 gene in severe asthma. Allergy, 70:212-219.
[24] Margolis LM, Lessard SJ, Ezzyat Y, Fielding RA, Rivas DA (2017). Circulating MicroRNA Are Predictive of Aging and Acute Adaptive Response to Resistance Exercise in Men. J Gerontol A Biol Sci Med Sci, 72:1319-1326.
[25] Liu Y, Liu W, Hu C, Xue Z, Wang G, Ding B, et al. (2011). MiR-17 modulates osteogenic differentiation through a coherent feed-forward loop in mesenchymal stem cells isolated from periodontal ligaments of patients with periodontitis. Stem Cells, 29:1804-1816.
[26] Liu Y, Liu R, Yang F, Cheng R, Chen X, Cui S, et al. (2017). miR-19a promotes colorectal cancer proliferation and migration by targeting TIA1. Mol Cancer, 16:53.
[27] Sun J, Jia Z, Li B, Zhang A, Wang G, Pu P, et al. (2017). MiR-19 regulates the proliferation and invasion of glioma by RUNX3 via beta-catenin/Tcf-4 signaling. Oncotarget, 8:110785-110796.
[28] Chang CJ, Chen YL, Hsieh CH, Liu YJ, Yu SL, Chen JJW, et al. (2017). HOXA5 and p53 cooperate to suppress lung cancer cell invasion and serve as good prognostic factors in non-small cell lung cancer. J Cancer, 8:1071-1081.
[29] Chen YQ, Yang TQ, Zhou B, Yang MX, Feng HJ, Wang YL (2019). HOXA5 overexpression promotes osteosarcoma cell apoptosis through the p53 and p38alpha MAPK pathway. Gene, 689:18-23.
[30] Peng X, Zha L, Chen A, Wang Z (2018). HOXA5 is a tumor suppressor gene that is decreased in gastric cancer. Oncol Rep, 40:1317-1329.
[31] Wu Y, Zhou T, Tang Q, Xiao J (2019). HOXA5 inhibits tumor growth of gastric cancer under the regulation of microRNA-196a. Gene, 681:62-68.
[32] Cao W, Huang H, Xia T, Liu C, Muhammad S, Sun C (2018). Homeobox a5 Promotes White Adipose Tissue Browning Through Inhibition of the Tenascin C/Toll-Like Receptor 4/Nuclear Factor Kappa B Inflammatory Signaling in Mice. Front Immunol, 9:647.
[33] Cao W, Xu Y, Luo D, Saeed M, Sun C (2018). Hoxa5 Promotes Adipose Differentiation via Increasing DNA Methylation Level and Inhibiting PKA/HSL Signal Pathway in Mice. Cell Physiol Biochem, 45:1023-1033.
[34] Mei B, Wang Y, Ye W, Huang H, Zhou Q, Chen Y, et al. (2019). LncRNA ZBTB40-IT1 modulated by osteoporosis GWAS risk SNPs suppresses osteogenesis. Hum Genet, 138:151-166.
[35] Hu K, Jiang W, Sun H, Li Z, Rong G, Yin Z (2019). Long noncoding RNA ZBED3-AS1 induces the differentiation of mesenchymal stem cells and enhances bone regeneration by repressing IL-1beta via Wnt/beta-catenin signaling pathway. J Cell Physiol.
[36] Liu C, Cao Z, Bai Y, Dou C, Gong X, Liang M, et al. (2019). LncRNA AK077216 promotes RANKL-induced osteoclastogenesis and bone resorption via NFATc1 by inhibition of NIP45. J Cell Physiol, 234:1606-1617.
[37] Yang L, Li Y, Gong R, Gao M, Feng C, Liu T, et al. (2019). The Long Non-coding RNA-ORLNC1 Regulates Bone Mass by Directing Mesenchymal Stem Cell Fate. Mol Ther, 27:394-410.
[38] Penny GD, Kay GF, Sheardown SA, Rastan S, Brockdorff N (1996). Requirement for Xist in X chromosome inactivation. Nature, 379:131-137.
[39] Li C, Wan L, Liu Z, Xu G, Wang S, Su Z, et al. (2018). Long non-coding RNA XIST promotes TGF-beta-induced epithelial-mesenchymal transition by regulating miR-367/141-ZEB2 axis in non-small-cell lung cancer. Cancer Lett, 418:185-195.
[40] Chen YK, Yen Y (2019). The Ambivalent Role of lncRNA Xist in Carcinogenesis. Stem Cell Rev, 15:314-323.
[41] Zhou T, Qin G, Yang L, Xiang D, Li S (2019). LncRNA XIST regulates myocardial infarction by targeting miR-130a-3p. J Cell Physiol, 234:8659-8667.
[1] Supplementary data Download
[1] Charlene Greenwood, John Clement, Anthony Dicken, Paul Evans, Iain Lyburn, Richard M. Martin, Nick Stone, Peter Zioupos, Keith Rogers. Age-Related Changes in Femoral Head Trabecular Microarchitecture[J]. Aging and disease, 2018, 9(6): 976-987.
[2] Manuel Scimeca, Federica Centofanti, Monica Celi, Elena Gasbarra, Giuseppe Novelli, Annalisa Botta, Umberto Tarantino. Vitamin D Receptor in Muscle Atrophy of Elderly Patients: A Key Element of Osteoporosis-Sarcopenia Connection[J]. Aging and disease, 2018, 9(6): 952-964.
[3] Li Jiao, Liu Xingyu, zuo Bin, Zhang Li. The Role of Bone Marrow Microenvironment in Governing the Balance between Osteoblastogenesis and Adipogenesis[J]. Aging and disease, 2016, 7(4): 514-525.
[4] Imai Kazuhiro. Analysis of Vertebral Bone Strength, Fracture Pattern, and Fracture Location: A Validation Study Using a Computed Tomography-Based Nonlinear Finite Element Analysis[J]. Aging and disease, 2015, 6(3): 180-187.
[5] Tetsuro Hida,Atsushi Harada,Shiro Imagama,Naoki Ishiguro. Managing Sarcopenia and Its Related-Fractures to Improve Quality of Life in Geriatric Populations[J]. Aging and Disease, 2014, 5(4): 226-237.
[6] James D. Dolbow,David R. Dolbow,Ashraf S. Gorgey,Robert A. Adler,David R. Gater. The Effects of Aging and Electrical Stimulation Exercise on Bone after Spinal Cord Injury[J]. Aging and Disease, 2013, 4(3): 141-153.
[7] Matti D. Allen,S. Jared McMillan,Cliff S. Klein,Charles L. Rice,Greg D. Marsh. Differential Age-related Changes in Bone Geometry between the Humerus and the Femur in Healthy Men[J]. Aging and Disease, 2012, 3(2): 156-163.
Viewed
Full text


Abstract

Cited

  Shared   
Copyright © 2014 Aging and Disease, All Rights Reserved.
Address: Aging and Disease Editorial Office 3400 Camp Bowie Boulevard Fort Worth, TX76106 USA
Fax: (817) 735-0408 E-mail: editorial@aginganddisease.org
Powered by Beijing Magtech Co. Ltd