Please wait a minute...
 Home  About the Journal Editorial Board Aims & Scope Peer Review Policy Subscription Contact us
 
Early Edition  //  Current Issue  //  Open Special Issues  //  Archives  //  Most Read  //  Most Downloaded  //  Most Cited
Aging and disease    2020, Vol. 11 Issue (3) : 470-476     DOI: 10.14336/AD.2019.0801
Short Communication |
Molecular Aging Markers in Patients with Klinefelter Syndrome
Pohl Eva1, Muschal Sina2, Kliesch Sabine2, Zitzmann Michael2, Rohayem Julia2, Gromoll Jörg3,*, Laurentino Sandra3
1Institute for Human Genetics, University of Münster, 48149 Münster, Germany
2Department of Clinical and Surgical Andrology, Centre of Reproductive Medicine and Andrology, University of Münster, 48149 Münster, Germany
3Institute of Reproductive and Regenerative Biology, Centre of Reproductive Medicine and Andrology, University of Münster, 48149 Münster, Germany
Download: PDF(458 KB)   HTML
Export: BibTeX | EndNote | Reference Manager | ProCite | RefWorks    
Abstract  

Molecular aging markers provide the opportunity for biological age determination in humans and to study factors, such as genetic determinants, affecting the ageing process. In males with Klinefelter syndrome (KS, non-mosaic karyotype 47, XXY), which is the most common sex chromosome aneuploidy, age-related morbidity and mortality are increased, and a significantly reduced life span has been observed. The aim of this study was to investigate whether Klinefelter patients exhibit molecular signs of premature ageing. We studied, specifically, age-associated DNA methylation patterns (by pyrosequencing) and relative telomere length (TL; by quantitative polymerase chain reaction) in blood in a cohort of Klinefelter patients (n=178 and 266 for DNA methylation and TL, respectively) aged 18-71 years and compared them to the data of age-matched healthy male (n = 184 and 196 for DNA methylation and TL, respectively) and female controls (n = 50). Age-associated DNA methylation patterns were not indicative of accelerated ageing in Klinefelter men. Significantly longer telomeres were found in the young Klinefelter subjects aged 18-24 years (mean=1.51 vs. 1.09 and 1.26 in female and male controls, respectively). However, telomere length in subsequent age groups showed no difference to controls. Gonosomal aneuploidy in Klinefelter syndrome is associated with higher baseline TL at adolescent age, but comparable TL with progressive age in other age groups.

Keywords ageing      DNA methylation      Klinefelter syndrome      telomere length     
Corresponding Authors: Gromoll Jörg   
About author:

These authors shared first-authorship.

Just Accepted Date: 27 January 2020   Issue Date: 13 May 2020
Service
E-mail this article
E-mail Alert
RSS
Articles by authors
Pohl Eva
Muschal Sina
Kliesch Sabine
Zitzmann Michael
Rohayem Julia
Gromoll Jörg
Laurentino Sandra
Cite this article:   
Pohl Eva,Muschal Sina,Kliesch Sabine, et al. Molecular Aging Markers in Patients with Klinefelter Syndrome[J]. Aging and disease, 2020, 11(3): 470-476.
URL:  
http://www.aginganddisease.org/EN/10.14336/AD.2019.0801     OR
TargetSequence (5’-3’)
ASPAforwardbiotin-GGAGGAATTTATGGGAATGAGTT
reverseAAATAATTTTACCTCCAACCCTATTC
sequencingACCCTATTCTCTAAATCTCA
ITGA2Bforwardbiotin-TAAGATTTGATTTTGGTTGGGGGTTTT
reverseAACCTTACTCCCAAAAAACTCATTTACA
sequencingACAATATACTCAATACTATACCT
PDE4CforwardGGGTAGAGGTTTGTAGTAGGT
reversebiotin-AACTCAAATCCCTCTC
sequencingGGTAGTTATAGTATGATTAGAGT
TelomereforwardCGGTTTGTTTGGGTTTGGGTTTGGGTTTGGGTTTGGGTT
reverseGGCTTGCCTTACCCTTACCCTTACCCTTACCCTTACCCT
HBGforwardTGTGCTGGCCCATCACTTTG
reverseACCAGCCACCACTTTCTGATAGG
Table 1  Primer sequences used for pyrosequencing and relative telomere length determination.
Figure 1.  Biological/epigenetic age was determined for individuals in the three groups and plotted against chronological age. There was a strong positive linear correlation between the two, regardless of the group.
GroupAge groupN (rTL)N (Age determination)
XY<254233
26-353434
36-452726
46-553838
56-653836
>661717
XXY<258744
26-356447
36-456650
46-553022
56-651511
>6644
XX<252222
26-351010
36-451010
46-5555
56-6533
>66--
Table 2  Number of samples per group and age group.
Figure 2.  Changes in telomere length with age, according to group. Telomeres suffer attrition with age, regardless of genotype, however telomere shortening shows a steeper decrease in KS men (m = -0.02) compared to XY males (m = -0.007; p < 0.001) and XX females (m = -0.004; p < 0.01) probands.
Figure 3.  Age-group associated changes in telomere length. Comparison of the average rTL in the three study groups reveals that KS patients present significantly longer telomeres than both XY males and XX females only in the youngest age group. * p < 0.05, *** p < 0.001.
[1] Baker GT, Sprott RL (1988). Biomarkers of aging. Exp Gerontol, 23:223-239.
[2] Horvath S, Raj K (2018). DNA methylation-based biomarkers and the epigenetic clock theory of aging. Nat Rev Genet, 19:371-384.
[3] Mather KA, Jorm AF, Parslow RAet al. (2011). Is telomere length a biomarker of aging? A review. J Gerontol A Biol Sci Med Sci, 66:202-213.
[4] Hayflick L, Moorhead PS (1961). The serial cultivation of human diploid cell strains. Exp Cell Res 25:585-621.
[5] Olovnikov AM (1996). Telomeres, telomerase, and aging: origin of the theory. Exp Gerontol, 31:443-448.
[6] Calado R, Young N (2012). Telomeres in disease. F1000 Med Rep, 4:8.
[7] Spyridopoulos I, Erben Y, Brummendorf THet al. (2008). Telomere gap between granulocytes and lymphocytes is a determinant for hematopoetic progenitor cell impairment in patients with previous myocardial infarction. Arterioscler Thromb Vasc Biol, 28:968-974.
[8] Yeh J-K, Wang C-Y (2016). Telomeres and Telomerase in Cardiovascular Diseases. Genes (Basel), 7:58
[9] Zhang J, Rane G, Dai Xet al. (2016). Ageing and the telomere connection: An intimate relationship with inflammation. Ageing Res Rev, 25:55-69.
[10] Kordinas V, Ioannidis A, Chatzipanagiotou S (2016). The Telomere/Telomerase System in Chronic Inflammatory Diseases. Cause or Effect? Genes (Basel), 7:60
[11] Horvath S (2013). DNA methylation age of human tissues and cell types. Genome Biol, 14:R115.
[12] Hannum G, Guinney J, Zhao Let al. (2013). Genome-wide methylation profiles reveal quantitative views of human aging rates. Mol Cell, 49:359-367.
[13] Weidner CI, Lin Q, Koch CMet al. (2014). Aging of blood can be tracked by DNA methylation changes at just three CpG sites. Genome Biol, 15:R24.
[14] Marioni RE, Shah S, McRae AFet al. (2015). DNA methylation age of blood predicts all-cause mortality in later life. Genome Biol, 16:25.
[15] Perna L, Zhang Y, Mons Uet al. (2016). Epigenetic age acceleration predicts cancer, cardiovascular, and all-cause mortality in a German case cohort. Clin Epigenetics, 8:64.
[16] Chen BH, Marioni RE, Colicino Eet al. (2016). DNA methylation-based measures of biological age: meta-analysis predicting time to death. Aging (Albany NY), 8:1844-1865.
[17] Christiansen L, Lenart A, Tan Qet al. (2016). DNA methylation age is associated with mortality in a longitudinal Danish twin study. Aging Cell 15:149-154.
[18] Lin Q, Wagner W (2015). Epigenetic Aging Signatures Are Coherently Modified in Cancer. PLoS Genet, 11:e1005334.
[19] Soriano-Tárraga C, Giralt-Steinhauer E, Mola-Caminal Met al. (2016). Ischemic stroke patients are biologically older than their chronological age. Aging (Albany NY), 8:2655-2666.
[20] Horvath S, Garagnani P, Bacalini MGet al. (2015). Accelerated epigenetic aging in Down syndrome. Aging, Cell 14:491-495.
[21] Obeid R, Hübner U, Bodis Met al. (2016). Plasma Amyloid Beta 1-42 and DNA Methylation Pattern Predict Accelerated Aging in Young Subjects with Down Syndrome. Neuromolecular Med, 18:593-601.
[22] Nieschlag E (2013). Klinefelter syndrome: the commonest form of hypogonadism, but often overlooked or untreated. Dtsch Arztebl Int, 110:347-353.
[23] Gravholt CH, Chang S, Wallentin Met al. (2018). Klinefelter Syndrome: Integrating Genetics, Neuropsychology, and Endocrinology. Endocr Rev, 39:389-423.
[24] Zitzmann M, Bongers R, Werler Set al. (2015). Gene expression patterns in relation to the clinical phenotype in Klinefelter syndrome. J Clin Endocrinol Metab, 100:E518-23.
[25] Bojesen A, Gravholt CH (2011). Morbidity and mortality in Klinefelter syndrome (47,XXY). Acta Paediatr, 100:807-813.
[26] Bojesen A, Stochholm K, Juul Set al. (2011). Socioeconomic trajectories affect mortality in Klinefelter syndrome. J Clin Endocrinol Metab, 96:2098-2104.
[27] Tüttelmann F, Luetjens CM, Nieschlag E (2006). Optimising workflow in andrology: a new electronic patient record and database. Asian J Androl 8:235-241.
[28] Cawthon RM (2002). Telomere measurement by quantitative PCR. Nucleic Acids Res, 30:e47.
[29] Meyer A, Salewsky B, Buchmann Net al. (2016). Relative Leukocyte Telomere Length, Hematological Parameters and Anemia - Data from the Berlin Aging Study II (BASE-II). Gerontology, 62:330-336.
[30] Pfaffl MW (2001). A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res, 29:e45.
[31] Englund A, Jonsson B, Zander CSet al. (2013). Changes in mortality and causes of death in the Swedish Down syndrome population. Am J Med Genet A, 161A:642-649.
[32] Vaziri H, Schächter F, Uchida Iet al. (1993). Loss of telomeric DNA during aging of normal and trisomy 21 human lymphocytes. Am J Med Genet, 52:661-667.
[33] Gruszecka A, Kopczyński P, Cudziło Det al. (2015). Telomere shortening in Down syndrome patients--when does it start? DNA Cell Biol, 34:412-417.
[34] Belling K, Russo F, Jensen ABet al. (2017). Klinefelter syndrome comorbidities linked to increased X chromosome gene dosage and altered protein interactome activity. Hum Mol Genet, 26:1219-1229.
[35] Tanaka K, Nishide J, Okazaki Ket al. (1999). Characterization of a fission yeast SUMO-1 homologue, pmt3p, required for multiple nuclear events, including the control of telomere length and chromosome segregation. Mol Cell Biol, 19:8660-8672.
[36] Xhemalce B, Riising EM, Baumann Pet al. (2007). Role of SUMO in the dynamics of telomere maintenance in fission yeast. Proc Natl Acad Sci U S A, 104:893-898.
[37] Kveiborg M, Gravholt CH, Kassem M (2001). Evidence of a normal mean telomere fragment length in patients with Ullrich-Turner syndrome Eur J Hum Genet, 9:877-879.
[38] Jylhävä J, Pedersen NL, Hägg S (2017). Biological Age Predictors. EbioMedicine, 21:29-36.
[39] Ventura Ferreira MS, Crysandt M, Ziegler Pet al. (2017). Evidence for a pre-existing telomere deficit in non-clonal hematopoietic stem cells in patients with acute myeloid leukemia. Ann Hematol, 96:1457-1461.
[40] Steegenga WT, Boekschoten MV, Lute Cet al. (2014). Genome-wide age-related changes in DNA methylation and gene expression in human PBMCs. Age (Dordr), 36:9648.
[41] Vetter VM, Meyer A, Karbasiyan Met al. (2019). Epigenetic Clock and Relative Telomere Length Represent Largely Different Aspects of Aging in the Berlin Aging Study II (BASE-II). J Gerontol A Biol Sci Med Sci, 74:27-32.
[42] Belsky DW, Moffitt TE, Cohen AAet al. (2018). Eleven Telomere, Epigenetic Clock, and Biomarker-Composite Quantifications of Biological Aging: Do They Measure the Same Thing? Am J Epidemiol 187:1220-1230.
[43] Kabacik S, Horvath S, Cohen Het al. (2018). Epigenetic ageing is distinct from senescence-mediated ageing and is not prevented by telomerase expression. Aging (Albany NY), 10:2800-2815.
[1] Zhang Shuyuan, Li Rongxia, Yang Yunyun, Chen Yu, Yang Shujun, Li Jian, Wu Cunjin, Kong Tao, Liu Tianlong, Cai Jun, Fu Li, Zhao Yanan, Hui Rutai, Zhang Weili. Longitudinal Association of Telomere Attrition with the Effects of Antihypertensive Treatment and Blood Pressure Lowering[J]. Aging and disease, 2020, 11(3): 494-508.
[2] Xiaojie Zhao, Yan Fan, Philip H. Vann, Jessica M. Wong, Nathalie Sumien, Johnny J. He. Long-term HIV-1 Tat Expression in the Brain Led to Neurobehavioral, Pathological, and Epigenetic Changes Reminiscent of Accelerated Aging[J]. Aging and disease, 2020, 11(1): 93-107.
[3] Yingying Ding, Haijiang Lin, Sujuan Zhou, Keran Wang, Lingling Li, Yucheng Zhang, Yuan Yao, Meiyang Gao, Xing Liu, Na He. Stronger Association between Insomnia Symptoms and Shorter Telomere Length in Old HIV-Infected Patients Compared with Uninfected Individuals[J]. Aging and disease, 2018, 9(6): 1010-1019.
[4] Lu Sha, Niu Zheng, Chen Yueming, Tu Qiaofeng, Zhang Yue, Chen Wenli, Tong Wenjuan, Zhang Zhifen. Repetitive Element DNA Methylation is Associated with Menopausal Age[J]. Aging and disease, 2018, 9(3): 435-443.
[5] Lu Jiao, Duan Xuefeng, Zhao Wenming, Wang Jing, Wang Haoyu, Zhou Kai, Fang Min. Aged Mice are More Resistant to Influenza Virus Infection due to Reduced Inflammation and Lung Pathology[J]. Aging and disease, 2018, 9(3): 358-373.
[6] Zgheib Nathalie K, Sleiman Fatima, Nasreddine Lara, Nasrallah Mona, Nakhoul Nancy, Isma’eel Hussain, Tamim Hani. Short Telomere Length is Associated with Aging, Central Obesity, Poor Sleep and Hypertension in Lebanese Individuals[J]. Aging and disease, 2018, 9(1): 77-89.
[7] Lourenco Joana, Serrano Antonio, Santos-Silva Alice, Gomes Marcos, Afonso Claudia, Freitas Paula, Paul Constanca, Costa Elisio. Cardiovascular Risk Factors Are Correlated with Low Cognitive Function among Older Adults Across Europe Based on The SHARE Database[J]. Aging and disease, 2018, 9(1): 90-101.
[8] Guzzardi Maria Angela, Iozzo Patricia, Salonen Minna K., Kajantie Eero, Airaksinen Riikka, Kiviranta Hannu, Rantakokko Panu, Eriksson Johan Gunnar. Exposure to Persistent Organic Pollutants Predicts Telomere Length in Older Age: Results from the Helsinki Birth Cohort Study[J]. Aging and disease, 2016, 7(5): 540-552.
[9] Kim Kyung Soo, Kwak Jin Wook, Lim Su Jin, Park Yong Kyun, Yang Hoon Shik, Kim Hyun Jik. Oxidative Stress-induced Telomere Length Shortening of Circulating Leukocyte in Patients with Obstructive Sleep Apnea[J]. Aging and disease, 2016, 7(5): 604-613.
[10] Igor Afanas’ev. New Nucleophilic Mechanisms of Ros-Dependent Epigenetic Modifications: Comparison of Aging and Cancer[J]. Aging and Disease, 2014, 5(1): 52-62.
[11] Jing-Zhi Guan,Wei-Ping Guan,Toyoki Maeda,Naoki Makino. The Subtelomere of Short Telomeres is Hypermethylated in Alzheimer’s Disease[J]. Aging and Disease, 2012, 3(2): 164-170.
[12] Aileen M. Lynch,Kevin J. Murphy,Brian F. Deighan,Julie-Ann. O'Reilly,Yuri K. Gun'ko,Thelma R. Cowley,Rodrigo E. Gonzalez-Reyes,Marina A. Lynch. The Impact of Glial Activation in the Aging Brain[J]. Aging and Disease, 2010, 1(3): 262-278.
Viewed
Full text


Abstract

Cited

  Shared   
Copyright © 2014 Aging and Disease, All Rights Reserved.
Address: Aging and Disease Editorial Office 3400 Camp Bowie Boulevard Fort Worth, TX76106 USA
Fax: (817) 735-0408 E-mail: editorial@aginganddisease.org
Powered by Beijing Magtech Co. Ltd