Please wait a minute...
 Home  About the Journal Editorial Board Aims & Scope Peer Review Policy Subscription Contact us
 
Early Edition  //  Current Issue  //  Open Special Issues  //  Archives  //  Most Read  //  Most Downloaded  //  Most Cited
Aging and disease
Orginal Article |
β-Hydroxybutyrate Suppresses Lipid Accumulation in Aged Liver through GPR109A-mediated Signaling
A Kyoung Lee1, Dae Hyun Kim1, EunJin Bang1, Yeon Ja Choi2, Hae Young Chung1,*
1Department of Pharmacy, College of Pharmacy, Pusan National University, Busan 46241, Korea
2Department of Biopharmaceutical Engineering, Division of Chemistry and Biotechnology, Dongguk University, Gyeongju 38066, Korea
Download: PDF(1075 KB)   HTML
Export: BibTeX | EndNote | Reference Manager | ProCite | RefWorks    
Abstract  

Dietary interventions such as prolonged calorie restriction (CR) and intermittent fasting provide health benefits including a reduction in the inflammatory burden and regulation of energy metabolism. During CR, β-hydroxybutyrate (BHB) level is elevated in the serum. BHB is a ligand of GPR109A, which inhibits lipolysis and exerts anti-inflammatory effects on cells. During aging, comorbidities related to dyslipidemia are significantly associated with fatty liver. However, the underlying mechanisms of BHB in hepatic ER stress and dyslipidemia are unclear and remain to be elucidated. Here, we used aged rats that were administered with BHB and compared the modulatory effects of BHB through the GPR109A/AMPK pathway on the hepatic endoplasmic reticulum (ER) stress and lipid accumulation to CR rats. BHB caused suppression of hepatic ER stress and lipid accumulation through GPR109A/AMPK pathway in the aged rats. Aged rats of both treatment groups showed reduced cAMP level and PKA phosphorylation. Furthermore, AMPK-Ser173 phosphorylation via PKA was decreased, whereas AMPK-Thr172 phosphorylation was increased by BHB and CR. Further supporting evidence was provided in HepG2 cells that BHB inhibited ER stress and lipid accumulation induced by palmitate. These results suggest that BHB activates GPR109A and regulates the activation of AMPK. These findings were further confirmed by GPR109A-siRNA transfection in vitro. In addition, BHB treatment elevated the protein levels of AMPK leading to significant inhibition of hepatic steatosis, whereas AMPK-siRNA treatment abolished these effects. Taken together, these findings suggest that BHB could be a effective molecule that mimics CR in ameliorating age-related hepatic lipid accumulation via GPR109A signaling pathway.

Keywords β-hydroxybutyrate      GPR109A      AMPK      ER stress      lipid accumulation      aged liver     
Corresponding Authors: Hae Young Chung   
About author:

These authors contributed equally to this work.

Just Accepted Date: 04 October 2019  
Service
E-mail this article
E-mail Alert
RSS
Articles by authors
A Kyoung Lee
Dae Hyun Kim
EunJin Bang
Yeon Ja Choi
Hae Young Chung
Cite this article:   
A Kyoung Lee,Dae Hyun Kim,EunJin Bang, et al. β-Hydroxybutyrate Suppresses Lipid Accumulation in Aged Liver through GPR109A-mediated Signaling[J]. Aging and disease, 10.14336/AD.2019.0926
URL:  
http://www.aginganddisease.org/EN/10.14336/AD.2019.0926     OR     http://www.aginganddisease.org/EN/Y/V/I/0
GeneForward (5’-3’)Reverse (3’-5’)
Rat
ACOX1TCAGCAGGAGAAATGGATGCTGGAAGTTTTCCCAAGTCCC
CPT1AAGCTGTGGCCTTCCAGTTCGGATGAAATCACACCCACCA
PPARγCCAGGTGACCCTCCTCAAGTCTGCAGCAGGTTGTCTTGGA
FASAGTGAGTGTACGGGAGGGCTGCTGGGACACATGTGATGGT
PPARαAGGAAGCCATTCTGCGACATCTCTGCAGGTGGAGCTTGAG
SCDGTTCTCTGAGACACACGCCGGGATGAAGCACATGAGCAGG
ACCGGCACTCTGATCTGGTCACGGCTCCGCACAGATTCTTCAA
Human
PPARαGGAAAGCCCACTCTGCCCCCTAGTCACCGAGGAGGGGCTCGA
SREBP-1cCGACATCGAAGACATGCTTCAGGGAAGGCTTCAAGAGAGGAGC
PPARγCATTCTGGCCCACCAACTTTGGTGGAGATGCAGGCTCCACTTTG
FASGACATCGTCCATTCGTTTGTGCGGATCACCTTCTTGAGCTCC
SCDGTTCTCTGAGACACACGCCGGGATGAAGCACATGAGCAGG
CPT1GGTCCAGGTAGAGCTCAGGCGTGCTCTGAGGCCTTTGTCA
ACOX1AGGTCACAGCTGTCCAACCATTACCCAGCCCTGGCTTAAT
Table 1  Primer sequences for qPCR.
YoungOldBHB 10BHB 100CR
Body Weight
Initial (g)609.5±23.1756.3±10.0758.3±14.6752.0±13.4752.0±18.2
Final (g)631.8±14.4789.0±14.2699.3±23.9706.5±13.6699.5±15.4
Food Intake
Initial (g)21.2±1.422.7±0.718.1±1.119.3±0.713.1
Final (g)23.0±0.925.3±1.520.5±0.920.8±1.615.1
Liver weight (g)20.5±0.7729.9±1.56###25.1±0.57*23.9±0.20**23.4±0.32**
Liver weight/Body weight(g/g)0.032±0.00120.038±0.0020#0.036±0.00080.034±0.0003*0.033±0.0005*
Table 2  Changes in body weight, food intake and liver weight intake during the experimental period.
Figure 1.  Changes in lipid and β-hydroxybutyrate levels in the serum. A series of plasma profiles from BHB-treated or calorie-restricted aged rats are shown. Aged rats (24 months old) were treated with BHB for 30 days (10 or 100 mg/kg/day P.O.) and the respective parameters were compared with young rats (6 months old). BHB was administered to the aged rats (n = 4 each). (A) Free fatty acid (FFA), (B) triglyceride (TG), and (C) β-hydroxybutyrate levels were measured after 30 days of BHB treatment. One-factor ANOVA was used to determine the significant differences. #p < 0.05, ##p < 0.01 vs. young; *p < 0.05, ***p < 0.001 vs. old. Y, young rats (6 months old).
Figure 2.  Effects of BHB on ER stress in the liver of the aged rats. Western blotting was performed to detect the levels of the ER stress markers (p-PERK and p-IRE), and the downstream signal p-JNK. Western blot results from three independent experiments were quantified by densitometry. One-factor ANOVA was used to determine the significant differences. #p < 0.05, ##p < 0.01, ###p < 0.001 vs. young; *p < 0.05, **p < 0.001, ***p < 0.001 vs. old.
Figure 3.  Changes in lipid accumulation, lipogenic genes, and β-oxidation genes in the livers of BHB-treated aged rats. (A) Hepatic TG contents, (B) mRNA expression of lipogenic genes, and (C) β-oxidation genes were evaluated by q-PCR. The results were normalized to the expression of a reference gene (GAPDH). One-factor ANOVA was used to determine the significant differences. #p < 0.05, ##p < 0.01, ###p < 0.001 vs. young; *p < 0.05, **p < 0.01, ***p < 0.001 vs. old. (D) Changes in lipid accumulation in calorie-restricted (CR) and BHB-treated aged rats. Aged liver tissues were stained with Oil red O to visualize lipid accumulation. Scale bar: 400 μm.
Figure 4.  Effects of BHB on palmitate-induced ER stress. HepG2 cells incubated with BHB (200 and 400 µM) for 3 h followed by treatment with palmitate (500 µM) for 24 h. Western blotting was performed to detect the levels of the ER stress markers (p-PERK and p-IRE). and the downstream signal p-JNK. Western blot results from three independent experiments were quantified by densitometry. One-factor ANOVA was used to determine the significant differences. ##p < 0.01 vs. normal; *p < 0.05, **p < 0.01 vs. palmitate (500 µM).
Figure 5.  Changes in lipid accumulation in the BHB-treated HepG2 cells. (A) Cellular TG content and (B) Oil red O staining of palmitate-induced HepG2 cells are shown. HepG2 cells were pre-treated with BHB (200 and 400 µM) for 3 h followed by treatment with palmitate (500 µM) for 24 h. Scale bar: 100 µm. mRNA expression of (C) lipogenic genes and (D) β-oxidation genes were evaluated by q-PCR. The results were normalized to the expression of a reference gene (GAPDH). One-factor ANOVA was used to determine the significant differences. #p < 0.05, ##p < 0.01, ###p < 0.001 vs. normal; *p < 0.05, **p < 0.01 vs. palmitate (500 µM).
Figure 6.  Changes in AMPK phosphorylation through the GPR109A signaling pathway in BHB-treated rat liver. (A) cAMP level in the liver homogenate. (B) Western blotting was performed to detect the levels of p-PKA, p-AMPK (Ser), p-AMPK (Thr), and AMPK in rat liver. Western blot results from three independent experiments were quantified by densitometry. One-factor ANOVA was used to determine the significant differences. #p < 0.05, ##p < 0.01 vs. young; *p < 0.05, **p < 0.01 vs. old.
Figure 7.  Effects of BHB on AMPK-Thr172 phosphorylation through the GPR109A signaling pathway in HepG2 cells. (A) Intracellular cAMP was treated with 400 µM BHB for 1 h in HepG2 cells. The results of Student’s t-test are shown. *p < 0.005 vs. normal. (B) HepG2 cells were incubated with BHB (200 and 400 µM) for 6 h. Western blotting was performed to detect the levels of p-PKA, p-AMPK (Ser), p-AMPK (Thr), and AMPK in HepG2 cells. Western blot results from three independent experiments were quantified by densitometry. One-factor ANOVA was used to determine the significant differences. *p < 0.05, **p < 0.01 vs. normal. (C) The possible mechanisms of the protective effects of BHB on hepatic lipid accumulation during aging are shown. Activation of GPR109A inhibited adenylyl cyclase and subsequent reduction in PKA activity by BHB. PKA dephosphorylation reduced AMPK-Ser173 and increased AMPK-Thr172 phosphorylation by BHB. Increased AMPK activity inhibited ER stress and lipid accumulation.
Figure 8.  BHB suppressed ER stress and lipid accumulation through GPR109A/PKA/AMPK in the cells. (A) The cells were treated with the BHB (400 µM) for 4 h. The cells pre-incubated with GPR109A-siRNA (20 nM) for 44 h were subjected to western blotting analysis using GAPDH as control. GPR109A, p-PKA, PKA, p-AMPK (Ser), p-AMPK (Thr), and AMPK levels were assessed. (B) The cAMP level measured after stimulation with BHB in the absence (-) or presence (+) of GPR109A-siRNA in the liver. The results of Student’s t-test are shown. #p < 0.05 vs. normal; *p < 0.05 vs. GPR109A-siRNA treated cells. (C) HepG2 cells were transfected and pre-incubated with PKI (10 µM) for 1 h. The cells were analyzed by Western blotting using PKA, p-PERK, PERK, p-IRE, IRE, and GAPDH antibodies. (D) The cells were treated with the BHB (400 µM) for 4 h. The cells pre-incubated with AMPK-siRNA (20 nM) for 44 h were subjected to western blotting analysis using GAPDH as control. AMPK and ER stress markers (p-PERK, PERK, p-IRE, and IRE) were assessed using cytosolic proteins from HepG2 cells. (E) The cells incubated with BHB (400 µM) for 4 h. The cells pre-transfected with AMPK-siRNA (20 nM) for 44 h were subjected to qPCR analysis using actin as a control. The mRNA expression of the lipogenic genes (SREBP-1c, PPAR, FAS, and SCD) was assessed. The results were normalized with respect to the actin level. #p < 0.05 vs. Normal; *p < 0.05 vs. AMPK-siRNA group.
[1] Chatrath H, Vuppalanchi R, Chalasani N (2012). Dyslipidemia in patients with nonalcoholic fatty liver disease. Semin Liver Dis, 32:22-29.
[2] Ipsen DH, Lykkesfeldt J, Tveden-Nyborg P (2018). Molecular mechanisms of hepatic lipid accumulation in non-alcoholic fatty liver disease. Cell Mol Life Sci : CMLS, 75:3313-3327.
[3] Zhou H, Liu R (2014). ER stress and hepatic lipid metabolism. Front Genet, 5:112-118.
[4] Musso G, Gambino R, Cassader M, Pagano G (2011). Prognosis and non-invasive methods to assess liver disease severity in non-alcoholic fatty liver disease (NAFLD): systematic review and meta-analysis. Ann Med, 43:617-649.
[5] Ron D, Walter P (2007). Signal integration in the endoplasmic reticulum unfolded protein response. Nat Rev Mol Cell Biol, 8:519-529.
[6] van Meer G, Voelker DR, Feigenson GW (2008). Membrane lipids: Where they are and how they behave. Nat Rev Mol Cell Biol, 9:112-124.
[7] Fang DL, Wan Y, Shen W, Cao J, Sun ZX, Yu HH, Zhang Q, Cheng WH, Chen J, Ning B (2013). Endoplasmic reticulum stress leads to lipid accumulation through upregulation of SREBP-1c in normal hepatic and hepatoma cells. Mol Cell Biochem, 381:127-137.
[8] Al-Regaiey KA (2016). The effects of calorie restriction on aging: a brief review. Eur Rev Med Pharmacol Sci, 20:2468-2473.
[9] Shimazu T, Hirschey MD, Newman J, He W, Shirakawa K, Le Moan N, Grueter CA, Lim H, Saunders LR, Stevens RD, Newgard CB, Farese RV Jr, Cabo RD, Ulrich S, Akassoglou K, Verdin E (2013). Suppression of oxidative stress by beta-hydroxybutyrate, an endogenous histone deacetylase inhibitor. Science, 339:211-214.
[10] Bae HR, Kim DH, Park MH, Lee B, Kim MJ, Lee EK, Chung KW, Kim SM, Im DS, Chung HY (2016). β-Hydroxybutyrate suppresses inflammasome formation by ameliorating endoplasmic reticulum stress via AMPK activation. Oncotarget, 7:66444-66454.
[11] Veech RL, Chance B, Kashiwaya Y, Lardy HA, Cahill GF Jr (2001). Ketone bodies, potential therapeutic uses. IUBMB Life 51:241-47.
[12] Newman JC, Verdin E (2014). Ketone bodies as signaling metabolites. Trends Endocrinol Metab 25:42-52.
[13] Veech RL, Bradshaw PC, Clarke K, Curtis W, Pawlosky R, King MT (2017). Ketone bodies mimic the life span extending properties of caloric restriction. IUBMB life, 69:305-314.
[14] Taggart AK, Kero J, Gan X, Cai TQ, Cheng K, Ippolito M, Ren N, Kaplan R, Wu K, Wu TJ, Jin L, Liaw C, Chen R, Richman J, Connolly D, Offermanns S, Wright SD, Waters MG (2005). (D)-beta-Hydroxybutyrate inhibits adipocyte lipolysis via the nicotinic acid receptor PUMA-G. J Biol Chem, 280:26649-26652.
[15] Jadeja RN, Jones MA, Fromal O, Powell FL, Khurana S, Singh N, Martin PM (2019). Loss of GPR109A/HCAR2 induces aging-associated hepatic steatosis. Aging (Albany NY), 11:386-400.
[16] Fu S.P., Wang W., Liu B.R., Yang H.M., Ji H., Yang Z.Q., Guo B., Liu J.X., andWang J.F. (2015). beta-Hydroxybutyric sodium salt inhibition of growth hormone and prolactin secretion via the cAMP/PKA/CREB and AMPK signaling pathways in dairy cow anterior pituitary cells. Int J Mol Sci 16, 4265-4280.
[17] Djouder N, Tuerk RD, Suter M, Salvioni P, Thali RF, Scholz R, Vaahtomeri K, Auchli Y, Rechsteiner H, Brunisholz RA, Viollet B, Mäkelä TP, Wallimann T, Neumann D, Krek W (2010). PKA phosphorylates and inactivates AMPKalpha to promote efficient lipolysis. EMBO J, 29:469-481.
[18] Aw DK, Sinha RA, Xie SY, Yen PM (2014). Differential AMPK phosphorylation by glucagon and metformin regulates insulin signaling in human hepatic cells. Biochem Biophys Res Commun, 447:569-573.
[19] Li H, Min Q, Ouyang C, Lee J, He C, Zou MH, Xie Z (2014). AMPK activation prevents excess nutrient-induced hepatic lipid accumulation by inhibiting mTORC1 signaling and endoplasmic reticulum stress response. Biochim Biophys Acta, 1842:1844-1854.
[20] Foretz M, Even PC, Viollet B (2018). AMPK Activation Reduces Hepatic Lipid Content by Increasing Fat Oxidation In Vivo. Int J Mol Sci, 19:E2826.
[21] Chung HY, Sung B, Jung KJ, Zou Y, Yu BP (2006). The molecular inflammatory process in aging. Antioxid Redox Signal, 8:572-581.
[22] Lin HV, Accili D (2011). Hormonal regulation of hepatic glucose production in health and disease. Cell Metab, 14:9-19.
[23] Karaskov E, Scott C, Zhang L, Teodoro T, Ravazzola M, Volchuk A (2006). Chronic palmitate but not oleate exposure induces endoplasmic reticulum stress, which may contribute to INS-1 pancreatic beta-cell apoptosis. Endocrinology, 147:3398-3407.
[24] Leamy AK, Egnatchik RA, Young JD (2013). Molecular mechanisms and the role of saturated fatty acids in the progression of non-alcoholic fatty liver disease. Prog Lipid Res, 52:165-174.
[25] Xu C, Bailly-Maitre B, Reed JC (2005). Endoplasmic reticulum stress: cell life and death decisions. J Clin Invest, 115:2656-2664.
[26] Baumeier C, Kaiser D, Heeren J, Scheja L, John C, Weise C, Eravci M, Lagerpusch M, Schulze G, Joost HG, Schwenk RW, Schürmann A (2015). Caloric restriction and intermittent fasting alter hepatic lipid droplet proteome and diacylglycerol species and prevent diabetes in NZO mice. Biochim Biophys Acta, 1851:566-576.
[27] Kim SH, Kwon DY, Kwak JH, Lee S, Lee YH, Yun J, Son TG, Jung YS (2018). Tunicamycin-Induced ER Stress is Accompanied with Oxidative Stress via Abrogation of Sulfur Amino Acids Metabolism in the Liver. Int J Mol Sci, 19:E4114.
[28] Kim KE, Jung Y, Min S, Nam M, Heo RW, Jeon BT, Song DH, Yi CO, Jeong EA, Kim H, Kim J, Jeong SY. Kwak W, Ryu DH, Horvath TL, Roh GS, Hwang GS (2016). Caloric restriction of db/db mice reverts hepatic steatosis and body weight with divergent hepatic metabolism. Sci Rep, 6:30111.
[29] Cahill GF Jr, Herrera MG, Morgan AP, Soeldner JS, Steinke J, Levy PL, Reichard GA Jr, Kipnis DM (1966). Hormone-fuel interrelationships during fasting. J Clin Invest, 45:1751-1769
[30] Kim DH, Park MH, Ha S, Bang EJ, Lee Y, Lee AK, Lee J, Yu BP, Chung HY (2019). Anti-inflammatory action of beta-hydroxybutyrate via modulation of PGC-1alpha and FoxO1, mimicking calorie restriction. Aging (Albany NY), 11:1283-1304.
[31] Pike NB (2005). Flushing out the role of GPR109A (HM74A) in the clinical efficacy of nicotinic acid. J Clin Invest, 115:3400-3403.
[32] Wong TP, Chan LK, Leung PS (2015). Involvement of the Niacin Receptor GPR109a in the Local Control of Glucose Uptake in Small Intestine of Type 2Diabetic Mice. Nutrients, 7:7543-7561.
[33] Hardie DG (1999). Roles of the AMP-activated/SNF1 protein kinase family in the response to cellular stress. Biochem Soc Symp, 64:13-27.
[34] Dong Y, Zhang M, Wang S, Liang B, Zhao Z, Liu C, Wu M, Choi HC, Lyons TJ, Zou MH (2010). Activation of AMP-Activated Protein Kinase Inhibits Oxidized LDL-Triggered Endoplasmic Reticulum Stress in Vivo. Diabetes, 59:1386-1396.
[35] Woods A, Williams JR, Muckett PJ, Mayer FV, Liljevald M, Bohlooly-Y M, Carling D (2017). Liver-Specific Activation of AMPK Prevents Steatosis on a High-Fructose Diet. Cell Rep, 18:3043-3051.
[1] Tan Yuan, Ke Minjing, Huang Zhijian, Chong Cheong-Meng, Cen Xiaotong, Lu Jia-Hong, Yao Xiaoli, Qin Dajiang, Su Huanxing. Hydroxyurea Facilitates Manifestation of Disease Relevant Phenotypes in Patients-Derived IPSCs-Based Modeling of Late-Onset Parkinson’s Disease[J]. Aging and disease, 2019, 10(5): 1037-1048.
[2] Wang Brian Z, Yang Jane J, Zhang Hongxia, Smith Charity A, Jin Kunlin. AMPK Signaling Regulates the Age-Related Decline of Hippocampal Neurogenesis[J]. Aging and disease, 2019, 10(5): 1058-1074.
[3] Li Xiaoting, Yu Lu, Gao Jing, Bi Xukun, Zhang Juhong, Xu Shiming, Wang Meihui, Chen Mengmeng, Qiu Fuyu, Fu Guosheng. Apelin Ameliorates High Glucose-Induced Downregulation of Connexin 43 via AMPK-Dependent Pathway in Neonatal Rat Cardiomyocytes[J]. Aging and disease, 2018, 9(1): 66-76.
[4] Xu Zhifang, Feng Wei, Shen Qian, Yu Nannan, Yu Kun, Wang Shenjun, Chen Zhigang, Shioda Seiji, Guo Yi. Rhizoma Coptidis and Berberine as a Natural Drug to Combat Aging and Aging-Related Diseases via Anti-Oxidation and AMPK Activation[J]. Aging and disease, 2017, 8(6): 760-777.
[5] Cai Pingtao, Ye Jingjing, Zhu Jingjing, Liu Dan, Chen Daqing, Wei Xiaojie, Johnson Noah R., Wang Zhouguang, Zhang Hongyu, Cao Guodong, Xiao Jian, Ye Junming, Lin Li. Inhibition of Endoplasmic Reticulum Stress is Involved in the Neuroprotective Effect of bFGF in the 6-OHDA-Induced Parkinson’s Disease Model[J]. Aging and disease, 2016, 7(4): 336-449.
[6] Isao Shimokawa,Lucas S. Trindade. Dietary Restriction and Aging in Rodents: a Current View on its Molecular Mechanisms[J]. Aging and Disease, 2010, 1(2): 89-107.
Viewed
Full text


Abstract

Cited

  Shared   
Copyright © 2014 Aging and Disease, All Rights Reserved.
Address: Aging and Disease Editorial Office 3400 Camp Bowie Boulevard Fort Worth, TX76106 USA
Fax: (817) 735-0408 E-mail: editorial@aginganddisease.org
Powered by Beijing Magtech Co. Ltd