Please wait a minute...
 Home  About the Journal Editorial Board Aims & Scope Peer Review Policy Subscription Contact us
 
Early Edition  //  Current Issue  //  Open Special Issues  //  Archives  //  Most Read  //  Most Downloaded  //  Most Cited
Aging and disease
Orginal Article |
Chondroprotective Effects of Combination Therapy of Acupotomy and Human Adipose Mesenchymal Stem Cells in Knee Osteoarthritis Rabbits via the GSK3β-Cyclin D1-CDK4/CDK6 Signaling Pathway
Xingyan An1,#, Tong Wang1,#, Wei Zhang1, Hongliang Yu2, Robert Chunhua Zhao2,*, Yan Guo3, Chunjiu Wang1, Luxue Qin1, Changqing Guo1,*
1School of Acupuncture-Moxibustion and Tuina, Beijing University of Chinese Medicine, Beijing, China.
2Institute of Basic Medical Sciences Chinese Academy of Medical Sciences, School of Basic Medicine Peking Union Medical College, Peking Union Medical College Hospital, Center of Excellence in Tissue Engineering Chinese Academy of Medical Sciences, Beijing Key Laboratory, Beijing, China.
3Acupuncture and Moxibustion Department, Beijing Traditional Chinese Medicine Hospital Affiliated to Capital Medical University, Beijing, China.
Download: PDF(1181 KB)   HTML
Export: BibTeX | EndNote | Reference Manager | ProCite | RefWorks    
Abstract  

Adipose-derived stem cells (ASCs) are highly chondrogenic and can be used to treat knee osteoarthritis (KOA) by alleviating cartilage defects. Acupotomy, a biomechanical therapy guided by traditional Chinese medicine theory, alleviates cartilage degradation and is widely used in the clinic to treat KOA by correcting abnormal mechanics. However, whether combining acupotomy with ASCs will reverse cartilage degeneration by promoting chondrocyte proliferation in KOA rabbits is unknown. The present study aimed to investigate the effects of combination therapy of acupotomy and ASCs on chondrocyte proliferation and to determine the underlying mechanism in rabbits with KOA induced by knee joint immobilization for 6 weeks. After KOA modeling, five groups of rabbits (acupotomy, ASCs, acupotomy + ASCs, model and control groups) received the indicated intervention for 4 weeks. The combination therapy significantly restored the KOA-induced decrease in passive range of motion (PROM) in the knee joint and reduced the elevated serum level of cartilage oligomeric matrix protein (COMP), a marker for cartilage degeneration. Furthermore, magnetic resonance imaging (MRI) and scanning electron microscopy (SEM) images showed that the combination therapy inhibited cartilage injury. The combination therapy also significantly blocked increases in the mRNA and protein expression of glycogen synthase kinase-3β (GSK3β) and decreases in the mRNA and protein expression of cyclin D1/CDK4 and cyclin D1/CDK6 in cartilage. These findings indicated that the combination therapy mitigated knee joint immobility, promoted chondrocyte proliferation and alleviated cartilage degeneration in KOA rabbits, and these effects may be mediated by specifically regulating the GSK3β-cyclin D1-CDK4/CDK6 pathway.

Keywords KOA      ASCs      acupotomy      chondrocytes      proliferation     
Corresponding Authors: Robert Chunhua Zhao,Changqing Guo. #These authors contributed equally to this work.   
Just Accepted Date: 04 January 2020   Online First Date: 04 January 2020   
Service
E-mail this article
E-mail Alert
RSS
Articles by authors
Xingyan An
Tong Wang
Wei Zhang
Hongliang Yu
Robert Chunhua Zhao
Yan Guo
Chunjiu Wang
Luxue Qin
Changqing Guo
Cite this article:   
Xingyan An,Tong Wang,Wei Zhang, et al. Chondroprotective Effects of Combination Therapy of Acupotomy and Human Adipose Mesenchymal Stem Cells in Knee Osteoarthritis Rabbits via the GSK3β-Cyclin D1-CDK4/CDK6 Signaling Pathway[J]. Aging and disease, 10.14336/AD.2019.1104
URL:  
http://www.aginganddisease.org/EN/10.14336/AD.2019.1104     OR     http://www.aginganddisease.org/EN/Y0/V/I/0
Figure 1.  The intervention points of the acupotome.
GenePrimer sequences
GSK3βForward: AGGAACACCAAAGGGAGC
Reverse: TACTCCAGGAGACGGCTACA
cyclin D1Forward: TCAAGTGTGACCCGGACTG
Reverse: GCTTCTTCCTCCACTTCCCC
CDK4Forward: GATGCGCCAGTTTCTAAGCG
Reverse: GGCCAGCTTAACTGTCCCAT
CDK6Forward: CGTGGAAGTTCAGACGTGGA
Reverse: AAAGCCTGTCTGGGAAGAGC
GAPDHForward: TTCACCACCATGGAGAAGGC
Reverse: CTCGTGGTTCACACCCATCA
Table 1  Primers used in this study.
Figure 2.  The combination therapy of acupotomy and ASCs blocked the KOA-induced decrease in the PROM score. The score analysis of PROM. Values are means ± SEMs. n = 6 per group. * p < 0.05, ** p < 0.01.
Figure 3.  The combination therapy of acupotomy and ASCs relieved cartilage degeneration and inhibited the increased levels of COMP in the serum of KOA rabbits. (A) MRI images in the coronal position. a: control group, b: model group, c: acupotomy group, d: ASCs group, e: acupotomy + ASCs group. (B) SEM images. (Magnification: a1, b1, c1, d1, e1 are at 5000×; a2, b2, c2, d2, e2 are at 10000×). (C) ELISA of serous COMP. Values are means ± SEMs. n = 6 per group. * p < 0.05, ** p < 0.01.
Figure 4.  The combination therapy of acupotomy and ASCs upregulated the decreased expression of cyclin D1, CDK4 and CDK6 in the cartilage of KOA rabbits. (A) Real-time PCR analysis of cyclin D1. (B) Real-time PCR analysis of CDK4. (C) Real-time PCR analysis of CDK6. (D) Western blot assay of cyclin D1. (E) Western blot assay of CDK4. (F) Immunohistochemical staining and optical density values of cyclin D1, CDK4 and CDK6. The values are expressed as the mean ± SEMs. n = 6 per group. * p < 0.05, ** p < 0.01. Scale bars = 250 μm.
Figure 5.  The combination therapy of acupotomy and ASCs affected chondrocyte proliferation by inhibiting the activation of GSK3β in the cartilage of KOA rabbits. (A) Real-time PCR analysis of GSK3β. (B) Western blot assay of GSK3β. (C) Immunohistochemical staining and optical density value of GSK3β. The values are expressed as the mean ± SEMs. n = 6 per group. * p < 0.05, ** p < 0.01. Scale bars = 250 μm.
[1] Glynjones S, Palmer AJ, Agricola R, Price AJ, Vincent TL, Weinans H, et al. (2015). Osteoarthritis. Lancet, 386:376-387.
[2] Karsdal MA, Michaelis M, Ladel C, Siebuhr AS, Bihlet AR, Andersen JR, et al. (2016). Disease-modifying treatments for osteoarthritis (DMOADs) of the knee and hip: lessons learned from failures and opportunities for the future. Osteoarthritis Cartilage, 24:2013-2021.
[3] Aigner T, Kim HA, Roach HI (2004). Apoptosis in osteoarthritis. Rheum Dis Clin North Am, 30:639-653.
[4] Steinert AF, Ghivizzani SC, Rethwilm A, Tuan RS, Evans CH, Nöth U (2007). Major biological obstacles for persistent cell-based regeneration of articular cartilage. Arthritis Res Ther, 9:213.
[5] Matsumoto T, Cooper GM, Gharaibeh B, Meszaros LB, Li G, Usas A, et al. (2009). Cartilage repair in a rat model of osteoarthritis through intraarticular transplantation of muscle-derived stem cells expressing bone morphogenetic protein 4 and soluble Flt-1. Arthritis Rheum, 60:1390-1405.
[6] Zou L, Liu J, Lu H (2017). Influence of protein kinase RIPK4 expression on the apoptosis and proliferation of chondrocytes in osteoarthritis. Mol Med Rep, 17:3078-3084.
[7] Shi J, Guo K, Su S, Li J, Li C (2018). miR-486-5p is upregulated in osteoarthritis and inhibits chondrocyte proliferation and migration by suppressing SMAD2. Mol Med Rep, 18:502-508.
[8] Ye D, Jian W, Feng J, Liao X (2018). Role of long noncoding RNA ZFAS1 in proliferation, apoptosis and migration of chondrocytes in osteoarthritis. Biomed Pharmacother, 104:825-831.
[9] Aigner T, Söder S, Gebhard PM, Mcalinden A, Haag J (2007). Mechanisms of disease: role of chondrocytes in the pathogenesis of osteoarthritis--structure, chaos and senescence. Nat Clin Pract Rheumatol, 3:391-399.
[10] Huang JG, Xia C, Zheng XP, Yi TT, Wang XY, Song G, et al. (2011). 17β-Estradiol promotes cell proliferation in rat osteoarthritis model chondrocytes via PI3K/Akt pathway. Cell Mol Biol Lett, 16:564-575.
[11] Zhou Q, Xu C, Cheng X, Liu Y, Yue M, Hu M, et al. (2016). Platelets promote cartilage repair and chondrocyte proliferation via ADP in a rodent model of osteoarthritis. Platelets, 27:212-222.
[12] Rodriguez-Merchan, EC (2013). Intraarticular injections of platelet-rich plasma (PRP) in the management of knee osteoarthritis. Arch Bone Jt Surg, 1:5-8.
[13] Filardo G, Kon E, Buda R, Timoncini A, Di MA, Cenacchi A, et al. (2011). Platelet-rich plasma intra-articular knee injections for the treatment of degenerative cartilage lesions and osteoarthritis.Knee Surg Sports Traumatol Arthrosc, 19:528-535.
[14] Mcalindon TE, Bannuru RR, Sullivan MC, Arden NK, Berenbaum F, et al. (2014). OARSI guidelines for the non-surgical management of knee osteoarthritis. Osteoarthritis Cartilage, 22:363-388.
[15] Tochigi Y, Vaseenon T, Heiner AD, Fredericks DC, Martin JA, Rudert MJ, et al. (2011). Instability dependency of osteoarthritis development in a rabbit model of graded anterior cruciate ligament transection. J Bone Joint Surg Am, 93:640-647.
[16] Wright T (2012). Biomechanical factors in osteoarthritis: the effects of joint instability. HSS J, 8:15.
[17] Bellamy N, Campbell J, Robinson V, Gee, Bourne R, Wells G (2006). Intraarticular corticosteroid for treatment of osteoarthritis of the knee. Cochrane Database Syst Rev (Online), 19:CD005328.
[18] Ma SN, Xie ZG, Guo Y, Yu JN, Lu J, Zhang W, et al. (2017). Effect of Acupotomy on FAK-PI3K Signaling Pathways in KOA Rabbit Articular Cartilages. Evid Based Complement Alternat Med, 2017:1-11.
[19] Liang CX, Guo Y, Tao L, Xiao H, Liu QG, Ma HF, et al. (2015). Effects of acupotomy intervention on regional pathological changes and expression of carti- lage-mechanics related proteins in rabbits with knee osteoarthritis. Zhen Ci Yan Jiu, 40:119-24, 140.
[20] Schindler OS (2011). Current concepts of articular cartilage repair. Acta Orthop Belg, 77:709.
[21] Lee J, Smeriglio P, Chu CR, Bhutani N (2017). Human iPSC-derived chondrocytes mimic juvenile chondrocyte function for the dual advantage of increased proliferation and resistance to IL-1β. Stem Cell Res Ther, 8:244.
[22] Zhao Z, Zhou X, Guan J, Wu M, Zhou J (2018). Co-implantation of bone marrow mesenchymal stem cells and chondrocytes increase the viability of chondrocytes in rat osteo-chondral defects. Oncol Lett, 15:7021-7027.
[23] Goto H, Inoko A, Inagaki M (2013). Cell cycle progression by the repression of primary cilia formation in proliferating cells. Cell Mol Life Sci, 70:3893-3905.
[24] Bonelli P, Tuccillo FM, Borrelli A, Schiattarella A, Buonaguro FM (2014). CDK/CCN and CDKI Alterations for Cancer Prognosis and Therapeutic Predictivity. BioMed Research International. Biomed Res Int, 2014:1-15.
[25] Leone G, Degregori J, Jakoi L, Cook JG, Nevins JR (1999). Collaborative role of E2F transcriptional activity and G1 cyclindependent kinase activity in the induction of S phase. Proc Natl Acad Sci U S A, 96:6626-6631.
[26] Stan S, Dong X, Yan Z, Arlotti J, Vogel V, Singh S (2007). Benzyl isothiocyanate, a constituent of cruciferous vegetables, inhibits growth of human breast cancer cells in culture and in vivo. J Am Acad Dermatol, 56:960-7.
[27] Xi S, Teng Y, Chen Y, Li J, Zhang Y,Liu S, et al. (2015). Jianpi Huayu Decoction Inhibits Proliferation in Human Colorectal Cancer Cells (SW480) by Inducing G0/G1-Phase Cell Cycle Arrest and Apoptosis. Evid Based Complement Alternat Med, 2015:236-506.
[28] Giacinti C, Giordano A (2006). Rb and cell cycle progression. Oncogene, 25:5220-5227.
[29] Genovese C, Trani D, Caputi M, Claudio PP (2006). Cell cycle control and beyond: emerging roles for the retinoblastoma gene family. Oncogene, 25:5201-5209.
[30] Santarpia L, Lippman SM, El-Naggar AK (2012). Targeting the MAPK-RAS-RAF signaling pathway in cancer therapy. Expert Opin Ther Targets, 16:103-119.
[31] Moghaddam SJ, Haghighi EN, Samiee S, Shahid N, Keramati AR, Dadgar S, et al. (2007). Immunohistochemical analysis of p53, cyclinD1, RB1, c-fos and N-ras gene expression in hepatocellular carcinoma in Iran. World J Gastroenterol, 98:588-593.
[32] Liang J, Slingerland JM (2003). Multiple roles of the PI3K/PKB (Akt) pathway in cell cycle progression. Cell Cycle, 2:336-342.
[33] Ogino S, Lochhead P, Giovannucci E, Meyerhardt JA, Fuchs CS, Chan AT (2014). Discovery of colorectal cancer PIK3CA mutation as potential predictive biomarker: power and promise of molecular pathological epidemiology. Oncogene, 33:2949-2955.
[34] Doble BW, Woodgett JR (2003). GSK-3: tricks of the trade for a multi-tasking kinase. J Cell Sci, 116:1175-86.
[35] Diehl JA, Zindy F, Sherr CJ (1997). Inhibition of cyclin D1 phosphorylation on threonine-286 prevents its rapid degradation via the ubiquitin-proteasome pathway. Genes Dev, 11: 957-972.
[36] Shakoori A, Ougolkov A, Yu ZW, Zhang B, Modarressi MH, Billadeau DD, et al. (2005). Deregulated GSK3 beta activity in colorectal cancer: Its association with tumor cell survival and proliferation. Biochem Biophys Res Commun, 334:1365-1373.
[37] Mishra R, Nagini S, Rana A (2015). Expression and inactivation of glycogen synthase kinase 3 alpha/ beta and their association with the expression of cyclin D1 and p53 in oral squamous cell carcinoma progression. Mol Cancer, 14:20.
[38] Liu L, Zhang H, Shi L, Zhang W, Yuan J, Chen X, et al. (2014). Inhibition of Rac1 activity induces G1/S phase arrest through the GSK3/cyclin D1 pathway in human cancer cells. Oncol Rep, 32:1395-1400.
[39] Guidance Suggestions for the Care and Use of Laboratory Animals. China: The Ministry of Science and Technology; 2006.
[40] Little C, Smith M (2008). Animal models of osteoarthritis. Curr Rheumatol Rev, 4:1-8.
[41] Musumeci G, Aiello F, Szychlinska M, Rosa MD, Castrogiovanni P, Mobasheri A (2015). Osteoarthritis in the XXIst century: risk factors and behaviours that influence disease onset and progression. Int J Mol Sci, 16:6093-6112.
[42] Neidhart M, Hauser N, Paulsson M, Dicesare PE, Michel BA, Häuselmann HJ (2017). Small fragments of cartilage oligomeric matrix protein in synovial fluid and serum as markers for cartilage degradation. Br J Rheumatol, 36:1151-1160.
[43] Hunt MA, Pollock CL, Kraus VB, Saxne T, Peters S, Huebner JL, et al. (2013). Relationships amongst osteoarthritis biomarkers, dynamic knee joint load, and exercise: results from a randomized controlled pilot study. BMC Musculoskelet Disord, 14:115.
[44] Bartels EM, Christensen R, Christensen P, Henriksen M, Bennett A Gudbergsen H, et al. (2014). Effect of a 16 weeks weight loss program on osteoarthritis biomarkers in obese patients with knee osteoarthritis: a prospective cohort study. Osteoarthritis Cartilage, 22:1817-1825.
[45] Mundermann A, King KB, Smith R L, Andriacchi TP (2010). Change in serum COMP concentration due to ambulatory load is not related to knee OA status. J Orthop Res, 27:1408-1413.
[46] Hoch JM, Mattacola CG, Mckeon JM, Howard JS, Lattermann C (2011). Serum cartilage oligomeric matrix protein (sCOMP) is elevated in patients with knee osteoarthritis: a systematic review and meta-analysis. Osteoarthritis Cartilage, 19:1396-1404.
[47] Stefan K, Anne-Christine BJ, Andrew J, Karsdal MA, Matthew S, Tim S, et al. (2015). Serum cartilage oligomeric matrix protein and development of radiographic and painful knee osteoarthritis. A community-based cohort of middle-aged women. Biomark, 20:557-564.
[48] Berthiaume F, Maguire TJ, Yarmush ML (2011). Tissue engineering and regenerative medicine: history, progress, and challenges. Annu Rev Chem Biomol Eng, 2:403-430.
[49] Tian K, Zhong W, Zheng X, Zhang J, Liu P, Zhang W, et al. (2015). Neuroleukin/Autocrine Motility Factor Receptor Pathway Promotes Proliferation of Articular Chondrocytes through Activation of AKT and Smad2/3. Sci Rep, 5:15-101.
[50] Gelse K, Von MK, Aigner T, Park J, Schneider H (2014). Articular cartilage repair by gene therapy using growth factor-producing mesenchymal cells. Arthritis Rheum, 48:430-441.
[51] Demoor M, Ollitrault D, Gomezleduc T, Bouyoucef M, Hervieu M, Fabre H, et al. (2014). Cartilage tissue engineering: molecular control of chondrocyte differentiation for proper cartilage matrix reconstruction. Biochim Biophys Acta, 8:2414-2440.
[52] Choi Y, Yoon DS, Lee KM, Choi SM, Lee MH, Park KH, et al. (2019) Enhancement of Mesenchymal Stem Cell-Driven Bone Regeneration by Resveratrol-Mediated SOX2 Regulation. Aging Dis, 10:818-833.
[53] Ma LS, Hu JC, Cao Y, Xie YL, Wang H, Fan ZP, et al. (2019) Maintained Properties of Aged Dental Pulp Stem Cells for Superior Periodontal Tissue Regeneration. Aging Dis, 10:793-806.
[54] Chen Zhiguo (2015). Cell Therapy for Parkinson’s Disease: New Hope from Reprogramming Technologies. Aging Dis, 6:499-503.
[55] da Silva Meirelles L, Chagastelles PC, Nardi NB (2006). Mesenchymal stem cells reside in virtually all post-natal organs and tissues. J Cell Sci , 119:2204-13.
[56] Kassem M, Abdallah BM (2008). Human bone-marrow-derived mesenchymal stem cells: biological characteristics and potential role in therapy of degenerative diseases. Cell Tissue Res, 331:157-163.
[57] Puissant B, Barreau C, Bourin P, Clavel C, Corre J, Bousquet C, et al. (2015). Immunomodulatory effect of human adipose tissue-derived adult stem cells: comparison with bone marrow mesenchymal stem cells. Br J Haematol, 129:118-129.
[58] Fellows CR, Csaba M, Roza Z, Khan IM, Ali M (2016). Adipose, bone marrow and synovial joint-derived mesenchymal stem cells for cartilage repair. Front Genet, 7:213.
[59] Mellorv LF, Mohitiasli M, Williams J, Kannan A, Dent MR, Guilak F, et al. (2015). Extracellular calcium modulates chondrogenic and osteogenic differentiation of human adipose-derived stem cells: a novel approach for osteochondral tissue engineering using a single stem cell source. Tissue Eng, 21: 2323-2333.
[60] Estes BT, Diekman BO, Guilak F (2008). Monolayer cell expansion conditions affect the chondrogenic potential of adipose-derived stem cells. Biotechnol Bioeng, 99:986-995.
[61] Zhou Q, Li B, Zhao J, Pan W, Xu J, Chen S (2016). IGF-I induces adipose derived mesenchymal cell chondrogenic differentiation in vitro and enhances chondrogenesis in vivo. In Vitro Cell Dev Biol Anim, 52:356-364.
[62] Khan WS, Adesida AB, Hardingham TE (2007). Hypoxic conditions increase hypoxia inducible transcription factor 2alpha and enhance chondrogenesis in stem cells from the infrapatellar fat pad of osteoarthritis patients. Arthritis Res Ther, 9: R55.
[63] Dubey NK, Wei HJ, Yu SH, Williams DF, Wang JR, Deng YH, et al (2019). Adipose-derived Stem Cells Attenuates Diabetic Osteoarthritis via Inhibition of Glycation-mediated Inflammatory Cascade. Aging Dis, 10:483-496.
[64] Desando G, Cavallo C, Sartoni F, Martini L, Parrilli A, Veronesi F, et al. (2013). Intra-articular delivery of adipose derived stromal cells attenuates osteoarthritis progression in an experimental rabbit model. Arthritis Res Ther, 15: R22.
[65] Jevotovsky DS, Alfonso AR, Einhorn TA, Chiu ES (2018). Osteoarthritis and stem cell therapy in humans: a systematic review. Osteoarthritis Cartilage, 26:711-729.
[66] Davatchi F, Sadeghi Abdollahi B, Mohyeddin M, Nikbin B (2016). Mesenchymal stem cell therapy for knee osteoarthritis: 5 years follow-up of three patients. Int J Rheum Dis, 19:219-225.
[67] Felson DT (2013). Osteoarthritis as a disease of mechanics. Osteoarthritis Cartilage, 21:10-15.
[68] Takacs J, Carpenter MG, Garland SJ, Hunt MA (2013). The Role of Neuromuscular Changes in Aging and Knee Osteoarthritis on Dynamic Postural Control. Aging Dis, 4:84-99.
[69] Takagi S, Omori G, Koga H, Endo K, Koga Y, Nawata A, et al. (2018). Quadriceps muscle weakness is related to increased risk of radiographic knee OA but not its progression in both women and men: the Matsudai Knee Osteoarthritis Survey. Knee Surg Sports Traumatol Arthrosc, 26:2607-2614.
[70] Mills K, Hunt MA, Leigh R, Ferber R (2013). A systematic review and meta-analysis of lower limb neuromuscular alterations associated with knee osteoarthritis during level walking. Clin Biomech, 28:713-724.
[71] Fahlman L, Sangeorzan E, Chheda N (2013). Older Subjects without Radiographic Knee Osteoarthritis: Weight, Height, and Body Mass Index. Aging Dis, 4:201-209.
[72] Ma TW, Zhang ZH, Song XP, Bai H, Li Y, Li XR, et al. (2018). Combined detection of COMP and CS846 biomarkers in experimental rat osteoarthritis: a potential approach for assessment and diagnosis of osteoarthritis. J Orthop Surg Res, 13:230.
[73] Matsushime H, Ewen ME, Strom DK, Kato JY, Hanks SK, Roussel MF, et al. (1992). Identification and Properties of an Atypical Catalytic Subunit (P34(Psk-J3)/Cdk4) for Mammalian-D Type-G1 Cyclins. Cell, 71:323-334.
[74] Meyerson M, Harlow E (1994). Identification of kinase activity for CDK6, a novel cyclin D partner. Mol Cell Biol, 14:2077-2086.
[75] Sherr CJ, Beach D, Shapiro GI (2016). Targeting CDK4 and CDK6: From Discovery to Therapy. Cancer Discov, 6:353-367.
[76] Zhang Q, Sakamoto K, Wagner KU (2014). D-type Cyclins are important downstream effectors of cytokine signaling that regulate the proliferation of normal and neoplastic mammary epithelial cells. Mol Cell Endocrinol, 382:583-592.
[77] Zhu XB, Yang SW, Lin WJ, Wang L, Ying JW, Ding YW, et al. (2016). Roles of Cell Cyle Regulators Cyclin D1, CDK4, and p53 in Knee Osteoarthritis. Genet Test Mol Biomarkers, 20:529-534.
[78] Zan PF, Yao J, Wu Z, Yang Y, Hu S, Li GD (2018). Cyclin D1 Gene Silencing Promotes IL-1-Induced Apoptosis in Rat Chondrocytes. J Cell Biochem, 119:290-299.
[79] Wu GW, Fan HL, Huang YP, Zheng CS, Ye JX, Liu XX (2014). Duhuo Jisheng Decoction-containing serum promotes proliferation of interleukin-1 beta-induced chondrocytes through the p16-cyclin D1/CDK4-Rb pathway. Mol Med Rep, 10:2525-2534.
[80] Fu CL, Zheng CS, Lin J, Ye JX, Mei YY, Pan CB, et al. (2017). Cibotium barometz polysaccharides stimulate chondrocyte proliferation in vitro by promoting G1/S cell cycle transition. Mol Med Rep, 15:3027-3034.
[81] Lin CX, Shao Y, Zeng C, Zhao C, Fang H, Wang LP, et al. (2018). Blocking PI3K/AKT signaling inhibits bone sclerosis in subchondral bone and attenuates post-traumatic osteoarthritis. J Cell Physiol, 233:6135-6147.
[82] Yu XJ, Han QB, Wen ZS, Ma L, Gao J, Zhou GB (2012). Gambogenic acid induces G1 arrest via GSK3 beta-dependent cyclin D1 degradation and triggers autophagy in lung cancer cells. Cancer Lett, 322:185-194.
[83] Lv CT, Qin WX, Zhu TH, Wei SJ, Hong K, Zhu WM, Chen RH, Huang CG (2015). Ophiobolin O Isolated from Aspergillus ustus Induces G1 Arrest of MCF-7 Cells through Interaction with AKT/GSK3 beta/Cyclin D1 Signaling. Mar Drugs, 13:431-443.
[84] Weng XP, Lin PD, Liu FY, Chen JS, Li HT, Huang LC, et al. (2014). Achyranthes bidentata polysaccharides activate the Wnt/β-catenin signaling pathway to promote chondrocyte proliferation. Int J Mol Med, 34:1045-1050.
[1] Qing He, Yuhao Gao, Tongxing Wang, Lujun Zhou, Wenxia Zhou, Zengqiang Yuan. Deficiency of Yes-Associated Protein Induces Cataract in Mice[J]. Aging and disease, 2019, 10(2): 293-306.
[2] Wanying Duan, Yuehua Pu, Haiyan Liu, Jing Jing, Yuesong Pan, Xinying Zou, Yilong Wang, Xingquan Zhao, Chunxue Wang, Yongjun Wang, Ka Sing Lawrence Wong, Ling Wei, Liping Liu, . Association between Leukoaraiosis and Symptomatic Intracranial Large Artery Stenoses and Occlusions: the Chinese Intracranial Atherosclerosis (CICAS) Study[J]. Aging and disease, 2018, 9(6): 1074-1083.
[3] Xuemei Chen, Yuexinzi Jin, Jian Chen, Xin Chen, Xiang Cao, Linjie Yu, Yun Xu. Relationship between White Matter Hyperintensities and Hematoma Volume in Patients with Intracerebral Hematoma[J]. Aging and disease, 2018, 9(6): 999-1009.
[4] Qin Wei, Chen Shiya, Yang Shasha, Xu Qian, Xu Chuanshan, Cai Jing. The Effect of Traditional Chinese Medicine on Neural Stem Cell Proliferation and Differentiation[J]. Aging and disease, 2017, 8(6): 792-811.
[5] Baugé Catherine,Girard Nicolas,Lhuissier Eva,Bazille Celine,Boumediene Karim. Regulation and Role of TGFβ Signaling Pathway in Aging and Osteoarthritis Joints[J]. Aging and Disease, 2014, 5(6): 394-405.
[6] Ning Chen,Jennifer Newcomb,Svitlana Garbuzova-Davis,Cyndy Davis Sanberg,Paul R. Sanberg,Alison E. Willing. Human Umbilical Cord Blood Cells Have Trophic Effects on Young and Aging Hippocampal Neurons in Vitro[J]. Aging and Disease, 2010, 1(3): 173-190.
Viewed
Full text


Abstract

Cited

  Shared   
Copyright © 2014 Aging and Disease, All Rights Reserved.
Address: Aging and Disease Editorial Office 3400 Camp Bowie Boulevard Fort Worth, TX76106 USA
Fax: (817) 735-0408 E-mail: editorial@aginganddisease.org
Powered by Beijing Magtech Co. Ltd