Please wait a minute...
 Home  About the Journal Editorial Board Aims & Scope Peer Review Policy Subscription Contact us
 
Early Edition  //  Current Issue  //  Open Special Issues  //  Archives  //  Most Read  //  Most Downloaded  //  Most Cited
Aging and disease    2019, Vol. 10 Issue (3) : 530-543     DOI: 10.14336/AD.2018.1220
Orginal Article |
The Neuronal Activation of Deep Cerebellar Nuclei Is Essential for Environmental Enrichment-Induced Post-Stroke Motor Recovery
Qun Zhang1, Jun-fa Wu1, Qi-li Shi2,3,4, Ming-yue Li5, Chuan-jie Wang1, Xin Wang6, Wen-yuan Wang4,1,*, Yi Wu1,*
1Department of Rehabilitation Medicine, Huashan Hospital, Fudan University, Shanghai, China.
2Stem Cell and Regenerative Medicine Laboratory, Ningbo Second Hospital, Zhejiang, China.
3University of Chinese Academy of Sciences, Beijing, China.
4Interdisciplinary Research Center on Biology and Chemistry, Shanghai Institute of Organic Chemistry, Chinese Academy of Sciences, Shanghai, China.
5Department of Rehabilitation Medicine, The Third Affiliated Hospital, Sun Yat-sen University, Guangzhou, China.
6Department of Rehabilitation, Clinical Medical College, Yangzhou University, Jiangsu, China
Download: PDF(1780 KB)   HTML
Export: BibTeX | EndNote | Reference Manager | ProCite | RefWorks    
Abstract  

The level of cerebellar activity in stroke patients has been shown to correlate with the extent of functional recovery. We reasoned that the cerebellum may be an important player in post-stroke rehabilitation. Because the neurons in the deep cerebellar nuclei (DCN) represent virtually all of the output from the cerebellum, in this study, using environmental enrichment (EE) to promote rehabilitation, we investigated the influence of the optogenetic neuronal modulation of DCN on EE-induced rehabilitation. We found that neuronal inhibition of the DCN almost completely blocked motor recovery in EE treated mice, but the stroke mice with neuronal activation of the DCN achieved a similar recovery level as those in the EE treated group. No difference was observed in anxiety-like behavior. Moreover, Htr2a in the DCN, the gene encoding 5-HT2A receptor, was shown to be a hub gene in the protein-protein interaction network identified using RNA-seq. This indicated that 5-HT2A receptor-mediated signaling may be responsible for DCN-dependent functional improvement in EE. We further verified this using the 5-HT2A receptor antagonist, MDL100907, to inhibit the function of 5-HT2A receptor in the DCN. This treatment resulted in impaired recovery in EE treated mice, who performed at a level as poor as the stroke-only group. Thus, this work contributes to an understanding of the importance of the DCN activation in EE-induced post-stroke rehabilitation. Attempts to clarify the mechanism of 5-HT2A receptor-mediated signaling in the DCN may also lead to the creation of a pharmacological mimetic of the benefits of EE-induced rehabilitation.

Keywords DCN      environmental enrichment      Htr2a      photothrombosis      optogenetics     
Corresponding Authors: Wang Wen-yuan,Wu Yi   
About author:

These authors contributed equally to this study.

Just Accepted Date: 07 January 2019   Issue Date: 28 May 2019
Service
E-mail this article
E-mail Alert
RSS
Articles by authors
Qun Zhang
Jun-fa Wu
Qi-li Shi
Ming-yue Li
Chuan-jie Wang
Xin Wang
Wen-yuan Wang
Yi Wu
Cite this article:   
Qun Zhang,Jun-fa Wu,Qi-li Shi, et al. The Neuronal Activation of Deep Cerebellar Nuclei Is Essential for Environmental Enrichment-Induced Post-Stroke Motor Recovery[J]. Aging and disease, 2019, 10(3): 530-543.
URL:  
http://www.aginganddisease.org/EN/10.14336/AD.2018.1220     OR     http://www.aginganddisease.org/EN/Y2019/V10/I3/530
GeneForward primerReverse primer
NgbCTGCTGCCTCTCTTCCAGTAAGCTGGTCAGGTACTCCTCC
GabrqAAATGTGCAGGATGGCCTGATGGCCAATTGAGTCTGGCTT
Htr1aCAGGGCAACAACACCACAACCGTTGGAGAGGCCAGTATCG
Htr2aGCTCTGTGCCGTCTGGATTCGGCTATGGTGAATGGGGTT
Chrm1TGCTGGTGCTCATCTCCTTCCCCATGAGCAGGTATGTGGT
Table 1  Primer sequences used for the validation of cerebellum-associated gene expression amongst upregulated genes.
Figure 1.  Effects of EE on motor recovery after PT

(A) Time course of behavioral tests. Motor assessments included the rotarod, cylinder and rung walking tests. BL: baseline data for rotarod. (B) Time course of the latency to fall off the rotarod. (C) The percentage of laterality in the cylinder test. (D-E) The percentage of limb slips in the rung walking test, for both forelimb and hindlimb. Data are expressed as the mean±SEM. *PT vs. PT+EE groups. *p≤0.05; **p≤0.01; ***p≤0.001.

Figure 2.  Effects of EE on anxiety-like behavior after PT

(A-C) The percentage of time mice spent in the open arm (A), closed arm (B) and center zone (C) of the elevated plus maze in each group. Data are expressed as the mean±SEM; *p≤0.05; **p≤0.01.

Figure 3.  Effects of optogenetic DCN stimulation on motor recovery

(A) Time course of behavioral tests after optogenetic stimulation of the DCN. Motor assessments included the rotarod, cylinder and rung walking tests. BL: baseline data for rotarod. FI: fiber implantation. (B) Schematic depiction of the optogenetic DCN stimulation used to modulate motor function. (C) Representative image of viral injection location targeted to the DCN. Positive expression of ChR2-GFP was observed in the DCN (100X magnification, scale bar =1mm). The morphology of the neurons (green) was shown in the inserted image (400X magnification, scale bar = 60μm). (D) Time course of the latency to fall off the rotarod in each group. (E) Histogram of the falling off latency in each group on the 14th and 21th day after stroke. (F) The percentage of laterality in the cylinder test in each group. (G) Histogram of the laterality percentage in each group on the 14th and 21th day after stroke. (H and J) The percent of forelimb slips (H) and hindlimb slips (J) in the rung walking test in each group. (I, K) Histogram of the limb slips percentage in each group on the 14th and 21th day after stroke. Data are expressed as the mean±SEM. *p≤0.05; **p≤0.01; ***p≤0.001; **** p≤0.0001.

Figure 4.  Effects of optogenetic DCN stimulation on anxiety-like behavior after PT

The percentage of time spent in the open arm (A), closed arm (B) and center zone (C) of the elevated plus maze. Data are expressed as the mean±SEM; *p≤0.05; **p≤0.01.

Figure 5.  Hierarchical clustering of transcripts in the DCN of PT and PT+EE groups

(A) Heat map of differentially expressed genes in the PT vs. the PT+EE group. Each group included three independent biological replicates. Red: high, Green: low, log scale from -2 to +1. (B) Volcano plots of significant differential expression of mRNAs in the PT versus the PT+EE group. The x-axis represents log2-fold change, and the y-axis represents -log10 (p-value). Blue dots: genes that were lower in the PT+EE group compared to the PT group. Red dots: genes that were higher in the PT+EE group compared to the PT group. Grey dots: genes that were unchanged in the PT+EE and PT groups. (C) Representative distribution of genes in the high expression subset and low expression subset in the PT+EE vs. PT group. Blue column: genes that were lower in the PT+EE group compared to the PT group. Red column: genes that were higher in the PT+EE group compared to the PT group. (D) PPI (protein-protein interaction) network of the upregulated genes. The red nodes are known cerebellar target genes. (E) RT-PCR validation of the expression of cerebellar-associated genes, from the list of upregulated genes. Data are expressed as the mean fold-change±SEM from three separate experiments, conducted in triplicate. **p≤0.01; ***p≤0.001.

Figure 6.  Effects of the <i>5-HT<sub>2A</sub></i> receptor antagonist <i>MDL</i>100907 on motor recovery after PT

(A) Relative expression of Htr2a mRNA in each group. (B) Time course of behavioral tests after MDL100907 administration to the DCN. Motor assessments included the rotarod, cylinder and rung walking tests. BL: baseline data for rotarod. PI: osmotic pump implantation. (C) Schematic depiction of the mini osmotic pump implantation filled with MDL100907. (D) The latency to fall off the rotarod in each group. (E) Histogram of the falling off latency in each group on the 14th and 21th day after stroke. (F) The percentage of laterality in cylinder test. (G) Histogram of the laterality percentage in each group on the 14th and 21th day after stroke. (H, J) The percentage of the forelimb (H) and hindlimb (J) slips in the rung walking test. (I, K) Histogram of the error slips percentage in each group on the 14th and 21th day after stroke. *p≤0.05; **p≤0.01, ****p≤0.0001.

Figure 7.  Effect of the <i>5-HT<sub>2A</sub></i> receptor antagonist <i>MDL</i>100907 on anxiety-like behavior after PT

The percentage of time mice spent in the open arm (A), closed arm (B) and center zone (C) of the elevated plus maze. Data are expressed as the mean±SEM; *p≤0.05; **p≤0.01; ***p≤0.001.

[1] Hendricks HT, van Limbeek J, Geurts AC, Zwarts MJ (2002). Motor recovery after stroke: a systematic review of the literature. Arch Phys Med Rehabil, 83:1629-37.
[2] Krishnamurthi RV, Feigin VL, Forouzanfar MH, Mensah GA, Connor M, Bennett DA, et al. (2013). Global and regional burden of first-ever ischaemic and haemorrhagic stroke during 1990-2010: findings from the Global Burden of Disease Study 2010. Lancet Global Health, 1:e259-81.
[3] Fletcher JA, Kozakewich HP, Hoffer FA, Lage JM, Weidner N, Tepper R, et al. (1991). Diagnostic relevance of clonal cytogenetic aberrations in malignant soft-tissue tumors. N Engl J Med, 324:436-43.
[4] Kim Y, Kim S, Kim J, Hong BY (2018). Modification of cerebellar afferent pathway in the subacute phase of stroke. J Stroke Cerebrovasc Dis, 27:2445-52.
[5] Takasawa M, Watanabe M, Yamamoto S, Hoshi T, Sasaki T, Hashikawa K, et al. (2002). Prognostic value of subacute crossed cerebellar diaschisis: single-photon emission CT study in patients with middle cerebral artery territory infarct. AJNR Am J Neuroradiol, 23:189-93.
[6] Elias GJB, Namasivayam AA, Lozano AM (2018). Deep brain stimulation for stroke: Current uses and future directions. Brain Stimul, 11:3-28.
[7] Yu K, Wu Y, Zhang Q, Xie H, Liu G, Guo Z, et al. (2014). Enriched environment induces angiogenesis and improves neural function outcomes in rat stroke model. J Neurol Sci, 347:275-80.
[8] Janssen H, Ada L, Bernhardt J, McElduff P, Pollack M, Nilsson M, et al. (2013). An enriched environment increases activity in stroke patients undergoing rehabilitation in a mixed rehabilitation unit: a pilot non-randomized controlled trial. Disabil Rehabil, 36:255-62.
[9] Di Garbo A, Mainardi M, Chillemi S, Maffei L, Caleo M (2011). Environmental enrichment modulates cortico-cortical interactions in the mouse. Plos One, 6:e25285.
[10] Sakamoto T, Endo S (2013). Deep cerebellar nuclei play an important role in two-tone discrimination on delay eyeblink conditioning in C57BL/6 mice. Plos One, 8:e59880.
[11] Sajadi A, Provost C, Pham B, Brouillette J (2016). Neurodegeneration in an animal model of chronic amyloid-beta oligomer infusion is counteracted by antibody treatment infused with osmotic pumps. J Vis Exp, 114: 54215.
[12] Kalogeraki E, Pielecka-Fortuna J, Huppe JM, Lowel S (2016). Physical Exercise Preserves Adult Visual Plasticity in Mice and Restores it after a Stroke in the Somatosensory Cortex. Front Aging Neurosci, 8:212.
[13] Greifzu F, Pielecka-Fortuna J, Kalogeraki E, Krempler K, Favaro PD, Schluter OM, et al. (2014). Environmental enrichment extends ocular dominance plasticity into adulthood and protects from stroke-induced impairments of plasticity. Proc Natl Acad Sci U S A, 111:1150-55.
[14] Silasi G, Murphy TH (2014). Stroke and the connectome: how connectivity guides therapeutic intervention. Neuron, 83:1354-68.
[15] Cooperrider J, Furmaga H, Plow E, Park HJ, Chen Z, Kidd G, et al. (2014). Chronic deep cerebellar stimulation promotes long-term potentiation, microstructural plasticity, and reorganization of perilesional cortical representation in a rodent model. J Neurosci, 34:9040-50.
[16] Shah AM, Ishizaka S, Cheng MY, Wang EH, Bautista AR, Levy S, et al. (2017). Optogenetic neuronal stimulation of the lateral cerebellar nucleus promotes persistent functional recovery after stroke. Sci Rep, 7:46612.
[17] Serteser M, Ozben T, Gumuslu S, Balkan S, Balkan E (2001). Biochemical evidence of crossed cerebellar diaschisis in terms of nitric oxide indicators and lipid peroxidation products in rats during focal cerebral ischemia. Acta Neurol Scand, 103:43-48.
[18] Takuwa H, Tajima Y, Kokuryo D, Matsuura T, Kawaguchi H, Masamoto K, et al. (2013). Hemodynamic changes during neural deactivation in awake mice: a measurement by laser-doppler flowmetry in crossed cerebellar diaschisis. Brain Res, 1537:350-55.
[19] Machado A, Baker KB (2012). Upside down crossed cerebellar diaschisis: proposing chronic stimulation of the dentatothalamocortical pathway for post-stroke motor recovery. Front Integr Neurosci, 6:20.
[20] Baker KB, Schuster D, Cooperrider J, Machado AG (2010). Deep brain stimulation of the lateral cerebellar nucleus produces frequency-specific alterations in motor evoked potentials in the rat in vivo. Exp Neurol, 226:259-64.
[21] Pytliak M, Vargova V, Mechirova V, Felsoci M (2011). Serotonin receptors - from molecular biology to clinical applications. Physiol Res, 60:15-25.
[22] Köhler S, Cierpinsky K, Kronenberg G, Adli M (2015). The serotonergic system in the neurobiology of depression: relevance for novel antidepressants. J Psychopharmacol, 30:13-22.
[23] Domínguez-López S, Howell R, Gobbi G (2012). Characterization of serotonin neurotransmission in knockout mice: implications for major depression. Rev Neuroscience, 23:429-43.
[24] González-Maeso J, Weisstaub NV, Zhou M, Chan P, Ivic L, Ang R, et al. (2007). Hallucinogens recruit specific cortical 5-HT2A receptor-mediated signaling pathways to affect behavior. Neuron, 53:439-52.
[25] Halberstadt AL, Powell SB, Geyer MA (2013). Role of the 5-HT2A receptor in the locomotor hyperactivity produced by phenylalkylamine hallucinogens in mice. Neuropharmacology, 70:218-27.
[26] Halberstadt AL, van der Heijden I, Ruderman MA, Risbrough VB, Gingrich JA, Geyer MA, et al. (2009). 5-HT2A and 5-HT2C receptors exert opposing effects on locomotor activity in mice. Neuropsychopharmacol, 34:1958-67.
[27] Saitow F, Murano M, Suzuki H (2009). Modulatory effects of serotonin on GABAergic synaptic transmission and membrane properties in the deep cerebellar nuclei. J Neurophysiol, 101:1361-74.
[28] Murano M, Saitow F, Suzuki H (2011). Modulatory effects of serotonin on glutamatergic synaptic transmission and long-term depression in the deep cerebellar nuclei. Neuroscience, 172:118-28.
[1] Nora S. Vyas,Yohan Lee,Kwangmi Ahn,Andrew Ternouth,Daniel R. Stahl,Ammar Al-Chalabi,John F. Powell,Basant K. Puri. Association of a Serotonin Receptor 2A Gene Polymorphism with Visual Sustained Attention in Early-Onset Schizophrenia Patients and their Non-Psychotic Siblings[J]. Aging and Disease, 2012, 3(4): 291-300.
Viewed
Full text


Abstract

Cited

  Shared   
Copyright © 2014 Aging and Disease, All Rights Reserved.
Address: Aging and Disease Editorial Office 3400 Camp Bowie Boulevard Fort Worth, TX76106 USA
Fax: (817) 735-0408 E-mail: editorial@aginganddisease.org
Powered by Beijing Magtech Co. Ltd